Incidental Mutation 'R4942:Ncan'
ID 383200
Institutional Source Beutler Lab
Gene Symbol Ncan
Ensembl Gene ENSMUSG00000002341
Gene Name neurocan
Synonyms Cspg3-rs, Tgfbit, Cspg3
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4942 (G1)
Quality Score 212
Status Not validated
Chromosome 8
Chromosomal Location 70545735-70573494 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70552944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 1096 (W1096L)
Ref Sequence ENSEMBL: ENSMUSP00000002412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002412]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000002412
AA Change: W1096L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002412
Gene: ENSMUSG00000002341
AA Change: W1096L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 23 30 N/A INTRINSIC
IG 43 157 9.63e-6 SMART
LINK 157 254 2.22e-56 SMART
LINK 258 356 4.72e-60 SMART
low complexity region 575 586 N/A INTRINSIC
low complexity region 602 632 N/A INTRINSIC
low complexity region 663 677 N/A INTRINSIC
EGF 963 996 6.5e-5 SMART
EGF_CA 998 1034 9.77e-9 SMART
CLECT 1040 1161 1.97e-41 SMART
CCP 1167 1223 2.53e-12 SMART
low complexity region 1225 1256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184696
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurocan is a chondroitin sulfate proteoglycan thought to be involved in the modulation of cell adhesion and migration.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for targeted null mutations are viable and fertile and exhibit normal behavior and brain anatomy; however, mild defects in long term potentiation were noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730522E02Rik A G 11: 25,720,472 (GRCm39) probably null Het
Adamts7 T C 9: 90,045,364 (GRCm39) S23P probably benign Het
Adamtsl1 T A 4: 86,259,451 (GRCm39) C824* probably null Het
Adgre1 A G 17: 57,713,903 (GRCm39) Y196C probably damaging Het
Arap1 A G 7: 101,051,009 (GRCm39) D542G possibly damaging Het
B3gat1 A G 9: 26,666,894 (GRCm39) D42G probably benign Het
Birc6 G A 17: 74,930,045 (GRCm39) A2412T probably damaging Het
Bnip5 T C 17: 29,122,232 (GRCm39) R420G probably benign Het
Bsn A G 9: 107,983,678 (GRCm39) Y3459H unknown Het
Cacnb1 T C 11: 97,893,809 (GRCm39) Y571C probably damaging Het
Cdk2ap2 G A 19: 4,147,508 (GRCm39) probably null Het
Cep57 A G 9: 13,724,723 (GRCm39) S265P probably damaging Het
Clca3a1 A G 3: 144,710,524 (GRCm39) I893T probably benign Het
Clca3a2 T A 3: 144,512,263 (GRCm39) E491V probably damaging Het
Cldn10 G A 14: 119,025,725 (GRCm39) G53S possibly damaging Het
Cobl A T 11: 12,204,185 (GRCm39) I832N probably damaging Het
Col9a2 T C 4: 120,910,316 (GRCm39) V487A possibly damaging Het
Cse1l C T 2: 166,771,714 (GRCm39) T325I probably damaging Het
Dlx6 A G 6: 6,863,468 (GRCm39) Q30R probably benign Het
Dnah8 T C 17: 30,948,116 (GRCm39) V1902A probably benign Het
Dusp8 A G 7: 141,635,965 (GRCm39) F542L possibly damaging Het
Emid1 T G 11: 5,079,430 (GRCm39) M323L probably benign Het
Ercc5 A G 1: 44,215,125 (GRCm39) D886G probably benign Het
Fam184b T C 5: 45,730,649 (GRCm39) E461G probably damaging Het
Fbn1 C A 2: 125,225,536 (GRCm39) C572F possibly damaging Het
Gigyf1 G T 5: 137,523,952 (GRCm39) V1041L possibly damaging Het
Grin3b A G 10: 79,811,556 (GRCm39) H714R probably damaging Het
Heatr1 A G 13: 12,428,391 (GRCm39) probably null Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lypd6b C A 2: 49,836,132 (GRCm39) H104Q probably benign Het
Man1a A T 10: 53,809,586 (GRCm39) probably null Het
Megf6 A T 4: 154,338,277 (GRCm39) D449V probably damaging Het
Mtor T C 4: 148,556,599 (GRCm39) V1003A probably benign Het
Ndor1 C T 2: 25,138,133 (GRCm39) probably null Het
Ndufaf1 T C 2: 119,490,547 (GRCm39) E171G possibly damaging Het
Nell1 T C 7: 49,770,397 (GRCm39) V152A possibly damaging Het
Nherf4 C A 9: 44,159,915 (GRCm39) G402* probably null Het
Nt5dc1 A T 10: 34,198,673 (GRCm39) V255E probably damaging Het
Or2a20 T A 6: 43,193,928 (GRCm39) F27Y probably damaging Het
Or2y1b A T 11: 49,208,375 (GRCm39) M1L probably null Het
Or52h7 A G 7: 104,214,212 (GRCm39) I261M probably benign Het
Or52z14 G A 7: 103,253,401 (GRCm39) R180H probably benign Het
Otud7a T C 7: 63,407,171 (GRCm39) I50T probably damaging Het
P2ry13 G A 3: 59,116,983 (GRCm39) T265I probably benign Het
Pde4d A G 13: 108,996,733 (GRCm39) S12G probably benign Het
Pigk C A 3: 152,450,154 (GRCm39) N219K probably damaging Het
Plcg1 T A 2: 160,595,509 (GRCm39) probably null Het
Psd2 A T 18: 36,111,717 (GRCm39) D114V probably damaging Het
Ptch1 A T 13: 63,672,884 (GRCm39) I770N probably benign Het
Ptprq A T 10: 107,524,290 (GRCm39) M481K probably benign Het
Rnf216 A C 5: 143,078,814 (GRCm39) M45R probably damaging Het
Rpsa T A 9: 119,960,129 (GRCm39) W231R probably benign Het
Ryr1 G T 7: 28,768,998 (GRCm39) T2797N probably damaging Het
Ryr3 A T 2: 112,666,602 (GRCm39) M1468K probably damaging Het
Slc6a7 A G 18: 61,137,589 (GRCm39) Y244H probably damaging Het
Slco6c1 T A 1: 97,009,049 (GRCm39) D462V probably damaging Het
Spata31d1b A T 13: 59,864,917 (GRCm39) E688D possibly damaging Het
Srpra G A 9: 35,126,766 (GRCm39) R508H probably benign Het
Tnrc18 A T 5: 142,773,737 (GRCm39) I181N unknown Het
Tnrc6a T C 7: 122,791,836 (GRCm39) F1785L probably damaging Het
Trio A T 15: 27,752,811 (GRCm39) D2174E probably benign Het
Ttn C T 2: 76,623,600 (GRCm39) V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 (GRCm39) probably benign Het
Vmn2r113 C T 17: 23,177,321 (GRCm39) P702S probably damaging Het
Vmn2r66 A T 7: 84,656,980 (GRCm39) W142R probably damaging Het
Vmn2r73 A G 7: 85,519,582 (GRCm39) Y459H probably damaging Het
Wsb2 C T 5: 117,515,550 (GRCm39) T385M probably damaging Het
Other mutations in Ncan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Ncan APN 8 70,567,921 (GRCm39) missense probably benign 0.24
IGL00924:Ncan APN 8 70,561,039 (GRCm39) missense possibly damaging 0.78
IGL01319:Ncan APN 8 70,550,212 (GRCm39) missense probably damaging 0.99
IGL01407:Ncan APN 8 70,554,607 (GRCm39) missense probably benign 0.17
IGL01528:Ncan APN 8 70,562,731 (GRCm39) missense probably benign 0.00
IGL01567:Ncan APN 8 70,560,984 (GRCm39) missense probably benign 0.09
IGL01808:Ncan APN 8 70,560,090 (GRCm39) critical splice donor site probably null
IGL02543:Ncan APN 8 70,561,221 (GRCm39) missense probably benign 0.37
IGL02551:Ncan APN 8 70,555,112 (GRCm39) missense probably damaging 1.00
IGL02899:Ncan APN 8 70,567,698 (GRCm39) missense possibly damaging 0.95
IGL02940:Ncan APN 8 70,562,735 (GRCm39) missense probably benign 0.02
IGL03058:Ncan APN 8 70,560,582 (GRCm39) missense possibly damaging 0.83
learned UTSW 8 70,550,731 (GRCm39) nonsense probably null
sagacious UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R0219:Ncan UTSW 8 70,567,984 (GRCm39) missense probably benign 0.08
R0538:Ncan UTSW 8 70,561,252 (GRCm39) missense possibly damaging 0.86
R0540:Ncan UTSW 8 70,567,809 (GRCm39) missense possibly damaging 0.93
R0854:Ncan UTSW 8 70,565,202 (GRCm39) missense probably damaging 1.00
R0918:Ncan UTSW 8 70,561,039 (GRCm39) missense possibly damaging 0.78
R1344:Ncan UTSW 8 70,560,819 (GRCm39) missense probably benign
R1575:Ncan UTSW 8 70,562,848 (GRCm39) missense probably benign 0.27
R1739:Ncan UTSW 8 70,560,736 (GRCm39) missense probably benign 0.03
R1847:Ncan UTSW 8 70,555,104 (GRCm39) missense probably damaging 0.96
R1859:Ncan UTSW 8 70,567,998 (GRCm39) missense possibly damaging 0.94
R2320:Ncan UTSW 8 70,560,868 (GRCm39) missense probably benign
R2370:Ncan UTSW 8 70,565,463 (GRCm39) missense probably benign 0.05
R3407:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3408:Ncan UTSW 8 70,564,801 (GRCm39) missense probably damaging 1.00
R3961:Ncan UTSW 8 70,562,950 (GRCm39) missense probably benign 0.05
R4155:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4156:Ncan UTSW 8 70,562,727 (GRCm39) missense possibly damaging 0.87
R4365:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 1.00
R4858:Ncan UTSW 8 70,556,705 (GRCm39) missense probably benign 0.00
R4925:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R4976:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5119:Ncan UTSW 8 70,567,675 (GRCm39) missense probably damaging 0.98
R5141:Ncan UTSW 8 70,565,487 (GRCm39) missense probably damaging 1.00
R5679:Ncan UTSW 8 70,565,276 (GRCm39) missense probably damaging 1.00
R5706:Ncan UTSW 8 70,554,667 (GRCm39) missense probably damaging 0.99
R5915:Ncan UTSW 8 70,550,731 (GRCm39) nonsense probably null
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6033:Ncan UTSW 8 70,565,240 (GRCm39) missense probably damaging 0.99
R6223:Ncan UTSW 8 70,562,604 (GRCm39) missense probably benign 0.02
R6390:Ncan UTSW 8 70,567,899 (GRCm39) missense probably benign 0.34
R6533:Ncan UTSW 8 70,549,007 (GRCm39) missense probably benign 0.01
R6836:Ncan UTSW 8 70,552,965 (GRCm39) missense possibly damaging 0.84
R6869:Ncan UTSW 8 70,560,557 (GRCm39) missense probably benign 0.08
R7229:Ncan UTSW 8 70,552,961 (GRCm39) missense possibly damaging 0.69
R7232:Ncan UTSW 8 70,564,738 (GRCm39) missense probably damaging 1.00
R7293:Ncan UTSW 8 70,567,861 (GRCm39) missense probably damaging 0.98
R7406:Ncan UTSW 8 70,562,749 (GRCm39) missense probably benign 0.00
R7474:Ncan UTSW 8 70,554,691 (GRCm39) missense possibly damaging 0.53
R7779:Ncan UTSW 8 70,567,661 (GRCm39) missense probably damaging 0.99
R7973:Ncan UTSW 8 70,550,225 (GRCm39) missense probably benign 0.00
R8113:Ncan UTSW 8 70,561,221 (GRCm39) missense possibly damaging 0.58
R8269:Ncan UTSW 8 70,560,330 (GRCm39) missense probably benign 0.01
R8947:Ncan UTSW 8 70,555,171 (GRCm39) missense probably damaging 0.98
R9324:Ncan UTSW 8 70,560,648 (GRCm39) missense possibly damaging 0.75
R9717:Ncan UTSW 8 70,554,628 (GRCm39) missense probably damaging 1.00
R9803:Ncan UTSW 8 70,560,751 (GRCm39) missense probably benign 0.06
Z1177:Ncan UTSW 8 70,550,122 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGATTTATGATGCCCACCAGTG -3'
(R):5'- ACCTGTGTGAACTGTGTGGC -3'

Sequencing Primer
(F):5'- ATGCCCACCAGTGAGTGATTG -3'
(R):5'- GGTCTCCTGACTCACAAGC -3'
Posted On 2016-04-27