Incidental Mutation 'R4942:Grin3b'
ID383211
Institutional Source Beutler Lab
Gene Symbol Grin3b
Ensembl Gene ENSMUSG00000035745
Gene Nameglutamate receptor, ionotropic, NMDA3B
SynonymsNR3B
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4942 (G1)
Quality Score131
Status Not validated
Chromosome10
Chromosomal Location79970715-79977190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79975722 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 714 (H714R)
Ref Sequence ENSEMBL: ENSMUSP00000048576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045085] [ENSMUST00000052885]
Predicted Effect probably damaging
Transcript: ENSMUST00000045085
AA Change: H714R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048576
Gene: ENSMUSG00000035745
AA Change: H714R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 39 60 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
PBPe 458 810 1.01e-82 SMART
Lig_chan-Glu_bd 459 522 6.6e-20 SMART
transmembrane domain 826 848 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
coiled coil region 950 984 N/A INTRINSIC
low complexity region 989 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052885
SMART Domains Protein: ENSMUSP00000056792
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 34 131 3.3e-44 PFAM
Pfam:Membralin 138 393 3.9e-130 PFAM
transmembrane domain 394 411 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 483 521 N/A INTRINSIC
low complexity region 531 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124536
SMART Domains Protein: ENSMUSP00000119572
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 4 101 1.6e-44 PFAM
Pfam:Membralin 108 297 7.7e-83 PFAM
Pfam:Membralin 316 387 5e-42 PFAM
transmembrane domain 388 405 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 477 515 N/A INTRINSIC
low complexity region 525 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126383
Predicted Effect unknown
Transcript: ENSMUST00000131816
AA Change: H131R
SMART Domains Protein: ENSMUSP00000122984
Gene: ENSMUSG00000035745
AA Change: H131R

DomainStartEndE-ValueType
Pfam:Lig_chan 1 368 2.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132080
Predicted Effect unknown
Transcript: ENSMUST00000149148
AA Change: H355R
SMART Domains Protein: ENSMUSP00000116887
Gene: ENSMUSG00000035745
AA Change: H355R

DomainStartEndE-ValueType
PBPe 100 452 1.01e-82 SMART
Lig_chan-Glu_bd 101 164 6.6e-20 SMART
transmembrane domain 468 490 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of an N-methyl-D-aspartate (NMDA) receptor. The encoded protein is found primarily in motor neurons, where it forms a heterotetramer with GRIN1 to create an excitatory glycine receptor. Variations in this gene have been proposed to be linked to schizophrenia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele show a mild impairment in motor learning or coordination, reduced home cage activity, a highly increased social interaction with familiar cagemates in their home cage but moderately increased anxiety-like behavior and reduced social interaction in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,903,258 R420G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
Adamts7 T C 9: 90,163,311 S23P probably benign Het
Adamtsl1 T A 4: 86,341,214 C824* probably null Het
Adgre1 A G 17: 57,406,903 Y196C probably damaging Het
Arap1 A G 7: 101,401,802 D542G possibly damaging Het
B3gat1 A G 9: 26,755,598 D42G probably benign Het
Birc6 G A 17: 74,623,050 A2412T probably damaging Het
Bsn A G 9: 108,106,479 Y3459H unknown Het
Cacnb1 T C 11: 98,002,983 Y571C probably damaging Het
Cdk2ap2 G A 19: 4,097,508 probably null Het
Cep57 A G 9: 13,813,427 S265P probably damaging Het
Clca1 A G 3: 145,004,763 I893T probably benign Het
Clca3a2 T A 3: 144,806,502 E491V probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cobl A T 11: 12,254,185 I832N probably damaging Het
Col9a2 T C 4: 121,053,119 V487A possibly damaging Het
Cse1l C T 2: 166,929,794 T325I probably damaging Het
Dlx6 A G 6: 6,863,468 Q30R probably benign Het
Dnah8 T C 17: 30,729,142 V1902A probably benign Het
Dusp8 A G 7: 142,082,228 F542L possibly damaging Het
Emid1 T G 11: 5,129,430 M323L probably benign Het
Ercc5 A G 1: 44,175,965 D886G probably benign Het
Fam184b T C 5: 45,573,307 E461G probably damaging Het
Fbn1 C A 2: 125,383,616 C572F possibly damaging Het
Gigyf1 G T 5: 137,525,690 V1041L possibly damaging Het
Heatr1 A G 13: 12,413,510 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lypd6b C A 2: 49,946,120 H104Q probably benign Het
Man1a A T 10: 53,933,490 probably null Het
Megf6 A T 4: 154,253,820 D449V probably damaging Het
Mtor T C 4: 148,472,142 V1003A probably benign Het
Ncan C A 8: 70,100,294 W1096L probably damaging Het
Ndor1 C T 2: 25,248,121 probably null Het
Ndufaf1 T C 2: 119,660,066 E171G possibly damaging Het
Nell1 T C 7: 50,120,649 V152A possibly damaging Het
Nt5dc1 A T 10: 34,322,677 V255E probably damaging Het
Olfr10 A T 11: 49,317,548 M1L probably null Het
Olfr434 T A 6: 43,216,994 F27Y probably damaging Het
Olfr619 G A 7: 103,604,194 R180H probably benign Het
Olfr652 A G 7: 104,565,005 I261M probably benign Het
Otud7a T C 7: 63,757,423 I50T probably damaging Het
P2ry13 G A 3: 59,209,562 T265I probably benign Het
Pde4d A G 13: 108,860,199 S12G probably benign Het
Pdzd3 C A 9: 44,248,618 G402* probably null Het
Pigk C A 3: 152,744,517 N219K probably damaging Het
Plcg1 T A 2: 160,753,589 probably null Het
Psd2 A T 18: 35,978,664 D114V probably damaging Het
Ptch1 A T 13: 63,525,070 I770N probably benign Het
Ptprq A T 10: 107,688,429 M481K probably benign Het
Rnf216 A C 5: 143,093,059 M45R probably damaging Het
Rpsa T A 9: 120,131,063 W231R probably benign Het
Ryr1 G T 7: 29,069,573 T2797N probably damaging Het
Ryr3 A T 2: 112,836,257 M1468K probably damaging Het
Slc6a7 A G 18: 61,004,517 Y244H probably damaging Het
Slco6c1 T A 1: 97,081,324 D462V probably damaging Het
Spata31d1b A T 13: 59,717,103 E688D possibly damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Tnrc18 A T 5: 142,787,982 I181N unknown Het
Tnrc6a T C 7: 123,192,613 F1785L probably damaging Het
Trio A T 15: 27,752,725 D2174E probably benign Het
Ttn C T 2: 76,793,256 V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 probably benign Het
Vmn2r113 C T 17: 22,958,347 P702S probably damaging Het
Vmn2r66 A T 7: 85,007,772 W142R probably damaging Het
Vmn2r73 A G 7: 85,870,374 Y459H probably damaging Het
Wsb2 C T 5: 117,377,485 T385M probably damaging Het
Other mutations in Grin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02754:Grin3b APN 10 79972889 missense possibly damaging 0.50
IGL03352:Grin3b APN 10 79973781 missense probably damaging 0.99
R0485:Grin3b UTSW 10 79974056 missense possibly damaging 0.68
R0927:Grin3b UTSW 10 79971228 missense probably benign 0.04
R1526:Grin3b UTSW 10 79974602 missense probably damaging 1.00
R1699:Grin3b UTSW 10 79975882 missense probably damaging 0.99
R1789:Grin3b UTSW 10 79973408 missense probably benign
R1916:Grin3b UTSW 10 79974598 missense probably damaging 1.00
R1991:Grin3b UTSW 10 79970912 missense probably benign
R1991:Grin3b UTSW 10 79974646 missense probably damaging 1.00
R4359:Grin3b UTSW 10 79972897 missense probably benign 0.00
R4817:Grin3b UTSW 10 79976898 missense probably benign 0.01
R4909:Grin3b UTSW 10 79977104 makesense probably null
R4981:Grin3b UTSW 10 79976357 intron probably benign
R5689:Grin3b UTSW 10 79974631 missense probably damaging 1.00
R5910:Grin3b UTSW 10 79973021 missense probably benign 0.00
R6132:Grin3b UTSW 10 79976440 missense probably damaging 1.00
R6242:Grin3b UTSW 10 79976179 missense probably damaging 1.00
R6262:Grin3b UTSW 10 79974369 missense probably benign 0.38
R6336:Grin3b UTSW 10 79976461 missense probably damaging 1.00
R6942:Grin3b UTSW 10 79976119 critical splice donor site probably null
R7201:Grin3b UTSW 10 79974078 missense possibly damaging 0.96
R7322:Grin3b UTSW 10 79975695 missense probably damaging 1.00
R7526:Grin3b UTSW 10 79973051 missense probably benign
R7707:Grin3b UTSW 10 79975901 missense possibly damaging 0.89
R8069:Grin3b UTSW 10 79977034 missense unknown
R8128:Grin3b UTSW 10 79977110 missense
Predicted Primers PCR Primer
(F):5'- TGCGGGTTACTGAATCTGAGC -3'
(R):5'- CATCTATGGACACCTCATAATCCAG -3'

Sequencing Primer
(F):5'- ACTGAATCTGAGCTCAGTGC -3'
(R):5'- TGGACACCTCATAATCCAGTAGTG -3'
Posted On2016-04-27