Incidental Mutation 'R4942:Llgl1'
ID383217
Institutional Source Beutler Lab
Gene Symbol Llgl1
Ensembl Gene ENSMUSG00000020536
Gene NameLLGL1 scribble cell polarity complex component
SynonymsLgl1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4942 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location60699723-60714186 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60709568 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 581 (P581L)
Ref Sequence ENSEMBL: ENSMUSP00000104359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]
Predicted Effect probably benign
Transcript: ENSMUST00000002889
SMART Domains Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812

DomainStartEndE-ValueType
LRR 55 78 1.08e-1 SMART
LRR 103 126 4.08e0 SMART
LRR 127 149 2.27e1 SMART
LRR 150 173 1.25e-1 SMART
LRR 222 244 6.78e1 SMART
LRR 245 268 2.86e-1 SMART
LRR 269 291 3.78e-1 SMART
LRR 316 339 2.82e0 SMART
LRR 340 362 2.27e2 SMART
low complexity region 403 420 N/A INTRINSIC
GEL 499 597 4.17e-25 SMART
GEL 617 709 1.72e-26 SMART
low complexity region 727 740 N/A INTRINSIC
GEL 745 838 2.24e-25 SMART
GEL 905 1039 1.13e-3 SMART
GEL 1056 1152 7.28e-16 SMART
GEL 1167 1263 5.51e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052346
AA Change: P581L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: P581L

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 278 379 1.2e-43 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 541 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 732 978 1.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108719
AA Change: P581L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: P581L

DomainStartEndE-ValueType
WD40 22 62 4.42e1 SMART
WD40 64 103 1.65e1 SMART
WD40 187 223 2.74e2 SMART
WD40 226 264 2.06e0 SMART
Pfam:LLGL 275 379 2e-48 PFAM
WD40 424 460 3.2e0 SMART
Blast:WD40 498 540 2e-13 BLAST
Blast:WD40 585 624 4e-9 BLAST
Pfam:Lgl_C 804 976 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154141
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,903,258 R420G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
Adamts7 T C 9: 90,163,311 S23P probably benign Het
Adamtsl1 T A 4: 86,341,214 C824* probably null Het
Adgre1 A G 17: 57,406,903 Y196C probably damaging Het
Arap1 A G 7: 101,401,802 D542G possibly damaging Het
B3gat1 A G 9: 26,755,598 D42G probably benign Het
Birc6 G A 17: 74,623,050 A2412T probably damaging Het
Bsn A G 9: 108,106,479 Y3459H unknown Het
Cacnb1 T C 11: 98,002,983 Y571C probably damaging Het
Cdk2ap2 G A 19: 4,097,508 probably null Het
Cep57 A G 9: 13,813,427 S265P probably damaging Het
Clca1 A G 3: 145,004,763 I893T probably benign Het
Clca3a2 T A 3: 144,806,502 E491V probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cobl A T 11: 12,254,185 I832N probably damaging Het
Col9a2 T C 4: 121,053,119 V487A possibly damaging Het
Cse1l C T 2: 166,929,794 T325I probably damaging Het
Dlx6 A G 6: 6,863,468 Q30R probably benign Het
Dnah8 T C 17: 30,729,142 V1902A probably benign Het
Dusp8 A G 7: 142,082,228 F542L possibly damaging Het
Emid1 T G 11: 5,129,430 M323L probably benign Het
Ercc5 A G 1: 44,175,965 D886G probably benign Het
Fam184b T C 5: 45,573,307 E461G probably damaging Het
Fbn1 C A 2: 125,383,616 C572F possibly damaging Het
Gigyf1 G T 5: 137,525,690 V1041L possibly damaging Het
Grin3b A G 10: 79,975,722 H714R probably damaging Het
Heatr1 A G 13: 12,413,510 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lypd6b C A 2: 49,946,120 H104Q probably benign Het
Man1a A T 10: 53,933,490 probably null Het
Megf6 A T 4: 154,253,820 D449V probably damaging Het
Mtor T C 4: 148,472,142 V1003A probably benign Het
Ncan C A 8: 70,100,294 W1096L probably damaging Het
Ndor1 C T 2: 25,248,121 probably null Het
Ndufaf1 T C 2: 119,660,066 E171G possibly damaging Het
Nell1 T C 7: 50,120,649 V152A possibly damaging Het
Nt5dc1 A T 10: 34,322,677 V255E probably damaging Het
Olfr10 A T 11: 49,317,548 M1L probably null Het
Olfr434 T A 6: 43,216,994 F27Y probably damaging Het
Olfr619 G A 7: 103,604,194 R180H probably benign Het
Olfr652 A G 7: 104,565,005 I261M probably benign Het
Otud7a T C 7: 63,757,423 I50T probably damaging Het
P2ry13 G A 3: 59,209,562 T265I probably benign Het
Pde4d A G 13: 108,860,199 S12G probably benign Het
Pdzd3 C A 9: 44,248,618 G402* probably null Het
Pigk C A 3: 152,744,517 N219K probably damaging Het
Plcg1 T A 2: 160,753,589 probably null Het
Psd2 A T 18: 35,978,664 D114V probably damaging Het
Ptch1 A T 13: 63,525,070 I770N probably benign Het
Ptprq A T 10: 107,688,429 M481K probably benign Het
Rnf216 A C 5: 143,093,059 M45R probably damaging Het
Rpsa T A 9: 120,131,063 W231R probably benign Het
Ryr1 G T 7: 29,069,573 T2797N probably damaging Het
Ryr3 A T 2: 112,836,257 M1468K probably damaging Het
Slc6a7 A G 18: 61,004,517 Y244H probably damaging Het
Slco6c1 T A 1: 97,081,324 D462V probably damaging Het
Spata31d1b A T 13: 59,717,103 E688D possibly damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Tnrc18 A T 5: 142,787,982 I181N unknown Het
Tnrc6a T C 7: 123,192,613 F1785L probably damaging Het
Trio A T 15: 27,752,725 D2174E probably benign Het
Ttn C T 2: 76,793,256 V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 probably benign Het
Vmn2r113 C T 17: 22,958,347 P702S probably damaging Het
Vmn2r66 A T 7: 85,007,772 W142R probably damaging Het
Vmn2r73 A G 7: 85,870,374 Y459H probably damaging Het
Wsb2 C T 5: 117,377,485 T385M probably damaging Het
Other mutations in Llgl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Llgl1 APN 11 60709999 missense probably benign 0.38
IGL01400:Llgl1 APN 11 60706490 missense probably damaging 1.00
IGL03066:Llgl1 APN 11 60706034 missense possibly damaging 0.75
IGL03174:Llgl1 APN 11 60706210 missense probably benign 0.15
IGL03306:Llgl1 APN 11 60711354 missense possibly damaging 0.92
R0284:Llgl1 UTSW 11 60712141 missense probably damaging 0.98
R1137:Llgl1 UTSW 11 60704733 missense probably benign 0.01
R1432:Llgl1 UTSW 11 60708554 missense probably damaging 1.00
R1769:Llgl1 UTSW 11 60707047 missense probably damaging 1.00
R1786:Llgl1 UTSW 11 60707240 missense probably benign 0.19
R1835:Llgl1 UTSW 11 60704730 missense probably benign 0.00
R1943:Llgl1 UTSW 11 60706016 missense probably benign
R2197:Llgl1 UTSW 11 60710039 missense possibly damaging 0.62
R2510:Llgl1 UTSW 11 60710036 missense probably damaging 1.00
R2568:Llgl1 UTSW 11 60708812 missense probably damaging 1.00
R3690:Llgl1 UTSW 11 60707002 missense probably damaging 1.00
R3853:Llgl1 UTSW 11 60707249 missense probably damaging 1.00
R4079:Llgl1 UTSW 11 60710284 splice site probably null
R4259:Llgl1 UTSW 11 60709568 missense probably benign
R4348:Llgl1 UTSW 11 60709568 missense probably benign
R4349:Llgl1 UTSW 11 60709568 missense probably benign
R4352:Llgl1 UTSW 11 60709568 missense probably benign
R4353:Llgl1 UTSW 11 60709568 missense probably benign
R4396:Llgl1 UTSW 11 60706008 missense probably benign
R4584:Llgl1 UTSW 11 60712082 missense probably damaging 0.99
R4594:Llgl1 UTSW 11 60706321 missense probably benign 0.15
R4628:Llgl1 UTSW 11 60709985 missense probably damaging 1.00
R4651:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4653:Llgl1 UTSW 11 60708651 missense possibly damaging 0.80
R4731:Llgl1 UTSW 11 60706225 nonsense probably null
R4869:Llgl1 UTSW 11 60707210 nonsense probably null
R4898:Llgl1 UTSW 11 60709568 missense probably benign
R4899:Llgl1 UTSW 11 60709568 missense probably benign
R4939:Llgl1 UTSW 11 60709979 critical splice acceptor site probably null
R4941:Llgl1 UTSW 11 60709568 missense probably benign
R4958:Llgl1 UTSW 11 60711435 missense probably benign 0.02
R4995:Llgl1 UTSW 11 60709724 missense probably benign 0.00
R4997:Llgl1 UTSW 11 60709568 missense probably benign
R5177:Llgl1 UTSW 11 60712007 missense possibly damaging 0.94
R5257:Llgl1 UTSW 11 60711563 unclassified probably null
R5258:Llgl1 UTSW 11 60711563 unclassified probably null
R5401:Llgl1 UTSW 11 60706471 missense probably benign
R5406:Llgl1 UTSW 11 60713184 missense probably damaging 0.99
R5432:Llgl1 UTSW 11 60707623 missense probably benign
R5587:Llgl1 UTSW 11 60710342 missense probably benign 0.00
R5732:Llgl1 UTSW 11 60709460 missense probably benign 0.00
R5758:Llgl1 UTSW 11 60708567 missense probably damaging 1.00
R5879:Llgl1 UTSW 11 60712980 missense probably benign 0.00
R6268:Llgl1 UTSW 11 60712163 missense probably benign 0.13
R6286:Llgl1 UTSW 11 60709532 missense probably damaging 1.00
R6455:Llgl1 UTSW 11 60709660 missense probably damaging 0.98
R6805:Llgl1 UTSW 11 60702865 missense probably benign 0.25
R6929:Llgl1 UTSW 11 60710353 nonsense probably null
R7274:Llgl1 UTSW 11 60705986 missense possibly damaging 0.89
R7889:Llgl1 UTSW 11 60707312 missense probably damaging 1.00
R7972:Llgl1 UTSW 11 60707312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAGTGAAGGCTTTGGTAC -3'
(R):5'- ACCTCGTGCCACATACCTAG -3'

Sequencing Primer
(F):5'- ACATTGTAGGTATTCAGGGGCC -3'
(R):5'- TACCTAGCCAGCACAGGG -3'
Posted On2016-04-27