Incidental Mutation 'R4942:Cacnb1'
ID383218
Institutional Source Beutler Lab
Gene Symbol Cacnb1
Ensembl Gene ENSMUSG00000020882
Gene Namecalcium channel, voltage-dependent, beta 1 subunit
SynonymsCchb1, Cchlb1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4942 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location98001508-98023034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98002983 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 571 (Y571C)
Ref Sequence ENSEMBL: ENSMUSP00000017552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017552] [ENSMUST00000092736] [ENSMUST00000103144] [ENSMUST00000107561] [ENSMUST00000107562]
Predicted Effect probably damaging
Transcript: ENSMUST00000017552
AA Change: Y571C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000017552
Gene: ENSMUSG00000020882
AA Change: Y571C

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 1.1e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
GuKc 228 409 5.57e-41 SMART
low complexity region 412 443 N/A INTRINSIC
low complexity region 523 543 N/A INTRINSIC
low complexity region 549 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092736
SMART Domains Protein: ENSMUSP00000090412
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 4.7e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
GuKc 273 454 5.57e-41 SMART
low complexity region 457 488 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103144
AA Change: Y651C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099433
Gene: ENSMUSG00000020882
AA Change: Y651C

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 1.4e-25 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
low complexity region 219 234 N/A INTRINSIC
GuKc 273 454 5.57e-41 SMART
low complexity region 457 488 N/A INTRINSIC
low complexity region 603 623 N/A INTRINSIC
low complexity region 629 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107561
SMART Domains Protein: ENSMUSP00000103186
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
Pfam:VGCC_beta4Aa_N 11 52 8e-27 PFAM
SH3 56 120 2.98e-2 SMART
low complexity region 135 146 N/A INTRINSIC
low complexity region 172 187 N/A INTRINSIC
GuKc 226 407 5.57e-41 SMART
low complexity region 410 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107562
SMART Domains Protein: ENSMUSP00000103187
Gene: ENSMUSG00000020882

DomainStartEndE-ValueType
low complexity region 41 53 N/A INTRINSIC
Pfam:VGCC_beta4Aa_N 58 99 4.2e-26 PFAM
SH3 103 167 2.98e-2 SMART
low complexity region 182 193 N/A INTRINSIC
GuKc 228 409 5.57e-41 SMART
low complexity region 412 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the calcium channel beta subunit family. It plays an important role in the calcium channel by modulating G protein inhibition, increasing peak calcium current, controlling the alpha-1 subunit membrane targeting and shifting the voltage dependence of activation and inactivation. Alternative splicing occurs at this locus and three transcript variants encoding three distinct isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals have reduced muscle mass, thin limbs, a curved spine, and flexed necks and extremeties. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,903,258 R420G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
Adamts7 T C 9: 90,163,311 S23P probably benign Het
Adamtsl1 T A 4: 86,341,214 C824* probably null Het
Adgre1 A G 17: 57,406,903 Y196C probably damaging Het
Arap1 A G 7: 101,401,802 D542G possibly damaging Het
B3gat1 A G 9: 26,755,598 D42G probably benign Het
Birc6 G A 17: 74,623,050 A2412T probably damaging Het
Bsn A G 9: 108,106,479 Y3459H unknown Het
Cdk2ap2 G A 19: 4,097,508 probably null Het
Cep57 A G 9: 13,813,427 S265P probably damaging Het
Clca1 A G 3: 145,004,763 I893T probably benign Het
Clca3a2 T A 3: 144,806,502 E491V probably damaging Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cobl A T 11: 12,254,185 I832N probably damaging Het
Col9a2 T C 4: 121,053,119 V487A possibly damaging Het
Cse1l C T 2: 166,929,794 T325I probably damaging Het
Dlx6 A G 6: 6,863,468 Q30R probably benign Het
Dnah8 T C 17: 30,729,142 V1902A probably benign Het
Dusp8 A G 7: 142,082,228 F542L possibly damaging Het
Emid1 T G 11: 5,129,430 M323L probably benign Het
Ercc5 A G 1: 44,175,965 D886G probably benign Het
Fam184b T C 5: 45,573,307 E461G probably damaging Het
Fbn1 C A 2: 125,383,616 C572F possibly damaging Het
Gigyf1 G T 5: 137,525,690 V1041L possibly damaging Het
Grin3b A G 10: 79,975,722 H714R probably damaging Het
Heatr1 A G 13: 12,413,510 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lypd6b C A 2: 49,946,120 H104Q probably benign Het
Man1a A T 10: 53,933,490 probably null Het
Megf6 A T 4: 154,253,820 D449V probably damaging Het
Mtor T C 4: 148,472,142 V1003A probably benign Het
Ncan C A 8: 70,100,294 W1096L probably damaging Het
Ndor1 C T 2: 25,248,121 probably null Het
Ndufaf1 T C 2: 119,660,066 E171G possibly damaging Het
Nell1 T C 7: 50,120,649 V152A possibly damaging Het
Nt5dc1 A T 10: 34,322,677 V255E probably damaging Het
Olfr10 A T 11: 49,317,548 M1L probably null Het
Olfr434 T A 6: 43,216,994 F27Y probably damaging Het
Olfr619 G A 7: 103,604,194 R180H probably benign Het
Olfr652 A G 7: 104,565,005 I261M probably benign Het
Otud7a T C 7: 63,757,423 I50T probably damaging Het
P2ry13 G A 3: 59,209,562 T265I probably benign Het
Pde4d A G 13: 108,860,199 S12G probably benign Het
Pdzd3 C A 9: 44,248,618 G402* probably null Het
Pigk C A 3: 152,744,517 N219K probably damaging Het
Plcg1 T A 2: 160,753,589 probably null Het
Psd2 A T 18: 35,978,664 D114V probably damaging Het
Ptch1 A T 13: 63,525,070 I770N probably benign Het
Ptprq A T 10: 107,688,429 M481K probably benign Het
Rnf216 A C 5: 143,093,059 M45R probably damaging Het
Rpsa T A 9: 120,131,063 W231R probably benign Het
Ryr1 G T 7: 29,069,573 T2797N probably damaging Het
Ryr3 A T 2: 112,836,257 M1468K probably damaging Het
Slc6a7 A G 18: 61,004,517 Y244H probably damaging Het
Slco6c1 T A 1: 97,081,324 D462V probably damaging Het
Spata31d1b A T 13: 59,717,103 E688D possibly damaging Het
Srpr G A 9: 35,215,470 R508H probably benign Het
Tnrc18 A T 5: 142,787,982 I181N unknown Het
Tnrc6a T C 7: 123,192,613 F1785L probably damaging Het
Trio A T 15: 27,752,725 D2174E probably benign Het
Ttn C T 2: 76,793,256 V15326I probably damaging Het
Ubap2 T A 4: 41,245,461 probably benign Het
Vmn2r113 C T 17: 22,958,347 P702S probably damaging Het
Vmn2r66 A T 7: 85,007,772 W142R probably damaging Het
Vmn2r73 A G 7: 85,870,374 Y459H probably damaging Het
Wsb2 C T 5: 117,377,485 T385M probably damaging Het
Other mutations in Cacnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Cacnb1 APN 11 98022364 missense possibly damaging 0.50
IGL02633:Cacnb1 APN 11 98022373 missense probably damaging 0.98
awkward UTSW 11 98005782 missense probably damaging 1.00
R1037:Cacnb1 UTSW 11 98005017 utr 3 prime probably benign
R2101:Cacnb1 UTSW 11 98005728 missense probably damaging 1.00
R2363:Cacnb1 UTSW 11 98012846 missense possibly damaging 0.87
R4159:Cacnb1 UTSW 11 98012274 missense probably damaging 1.00
R5360:Cacnb1 UTSW 11 98018271 critical splice donor site probably null
R5653:Cacnb1 UTSW 11 98009279 critical splice donor site probably null
R6137:Cacnb1 UTSW 11 98005782 missense probably damaging 1.00
R7154:Cacnb1 UTSW 11 98005133 missense probably damaging 0.99
R7163:Cacnb1 UTSW 11 98012900 missense probably benign 0.20
R7800:Cacnb1 UTSW 11 98009295 missense possibly damaging 0.56
R7816:Cacnb1 UTSW 11 98005289 missense probably damaging 1.00
Z1176:Cacnb1 UTSW 11 98022555 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAGACACATCTTGGGTGGTGTG -3'
(R):5'- TATCCCGCCAAGACACCTTTG -3'

Sequencing Primer
(F):5'- CTTGGGTGGTGTGCCCCTC -3'
(R):5'- GCCAAGACACCTTTGATGCTG -3'
Posted On2016-04-27