Mutagenetix > Incidental Mutation

Incidental Mutation 'R4942:Pde4d'

383224

Institutional Source

Beutler Lab

Gene Symbol

Pde4d

Ensembl Gene

ENSMUSG00000021699

Gene Name

phosphodiesterase 4D, cAMP specific

Synonyms

dunce, Dpde3, 9630011N22Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4942 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108449948-109953461 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 108860199 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 12 (S12G)

Ref Sequence

ENSEMBL: ENSMUSP00000136485 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000122041] [ENSMUST00000177907]

AlphaFold

Q01063

Predicted Effect

probably benign
Transcript: ENSMUST00000122041
AA Change: S12G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000113488
Gene: ENSMUSG00000021699
AA Change: S12G

Domain	Start	End	E-Value	Type
HDc	398	573	1.12e-2	SMART
low complexity region	721	736	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133929

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151111

Predicted Effect

probably benign
Transcript: ENSMUST00000177907
AA Change: S12G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000136485
Gene: ENSMUSG00000021699
AA Change: S12G

Domain	Start	End	E-Value	Type
HDc	398	573	1.12e-2	SMART
low complexity region	721	736	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit delayed growth, female infertility associated with impaired ovulation, and reduced postnatal viability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	C	17: 28,903,258	R420G	probably benign	Het
5730522E02Rik	A	G	11: 25,770,472		probably null	Het
Adamts7	T	C	9: 90,163,311	S23P	probably benign	Het
Adamtsl1	T	A	4: 86,341,214	C824*	probably null	Het
Adgre1	A	G	17: 57,406,903	Y196C	probably damaging	Het
Arap1	A	G	7: 101,401,802	D542G	possibly damaging	Het
B3gat1	A	G	9: 26,755,598	D42G	probably benign	Het
Birc6	G	A	17: 74,623,050	A2412T	probably damaging	Het
Bsn	A	G	9: 108,106,479	Y3459H	unknown	Het
Cacnb1	T	C	11: 98,002,983	Y571C	probably damaging	Het
Cdk2ap2	G	A	19: 4,097,508		probably null	Het
Cep57	A	G	9: 13,813,427	S265P	probably damaging	Het
Clca1	A	G	3: 145,004,763	I893T	probably benign	Het
Clca3a2	T	A	3: 144,806,502	E491V	probably damaging	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Cobl	A	T	11: 12,254,185	I832N	probably damaging	Het
Col9a2	T	C	4: 121,053,119	V487A	possibly damaging	Het
Cse1l	C	T	2: 166,929,794	T325I	probably damaging	Het
Dlx6	A	G	6: 6,863,468	Q30R	probably benign	Het
Dnah8	T	C	17: 30,729,142	V1902A	probably benign	Het
Dusp8	A	G	7: 142,082,228	F542L	possibly damaging	Het
Emid1	T	G	11: 5,129,430	M323L	probably benign	Het
Ercc5	A	G	1: 44,175,965	D886G	probably benign	Het
Fam184b	T	C	5: 45,573,307	E461G	probably damaging	Het
Fbn1	C	A	2: 125,383,616	C572F	possibly damaging	Het
Gigyf1	G	T	5: 137,525,690	V1041L	possibly damaging	Het
Grin3b	A	G	10: 79,975,722	H714R	probably damaging	Het
Heatr1	A	G	13: 12,413,510		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Lypd6b	C	A	2: 49,946,120	H104Q	probably benign	Het
Man1a	A	T	10: 53,933,490		probably null	Het
Megf6	A	T	4: 154,253,820	D449V	probably damaging	Het
Mtor	T	C	4: 148,472,142	V1003A	probably benign	Het
Ncan	C	A	8: 70,100,294	W1096L	probably damaging	Het
Ndor1	C	T	2: 25,248,121		probably null	Het
Ndufaf1	T	C	2: 119,660,066	E171G	possibly damaging	Het
Nell1	T	C	7: 50,120,649	V152A	possibly damaging	Het
Nt5dc1	A	T	10: 34,322,677	V255E	probably damaging	Het
Olfr10	A	T	11: 49,317,548	M1L	probably null	Het
Olfr434	T	A	6: 43,216,994	F27Y	probably damaging	Het
Olfr619	G	A	7: 103,604,194	R180H	probably benign	Het
Olfr652	A	G	7: 104,565,005	I261M	probably benign	Het
Otud7a	T	C	7: 63,757,423	I50T	probably damaging	Het
P2ry13	G	A	3: 59,209,562	T265I	probably benign	Het
Pdzd3	C	A	9: 44,248,618	G402*	probably null	Het
Pigk	C	A	3: 152,744,517	N219K	probably damaging	Het
Plcg1	T	A	2: 160,753,589		probably null	Het
Psd2	A	T	18: 35,978,664	D114V	probably damaging	Het
Ptch1	A	T	13: 63,525,070	I770N	probably benign	Het
Ptprq	A	T	10: 107,688,429	M481K	probably benign	Het
Rnf216	A	C	5: 143,093,059	M45R	probably damaging	Het
Rpsa	T	A	9: 120,131,063	W231R	probably benign	Het
Ryr1	G	T	7: 29,069,573	T2797N	probably damaging	Het
Ryr3	A	T	2: 112,836,257	M1468K	probably damaging	Het
Slc6a7	A	G	18: 61,004,517	Y244H	probably damaging	Het
Slco6c1	T	A	1: 97,081,324	D462V	probably damaging	Het
Spata31d1b	A	T	13: 59,717,103	E688D	possibly damaging	Het
Srpr	G	A	9: 35,215,470	R508H	probably benign	Het
Tnrc18	A	T	5: 142,787,982	I181N	unknown	Het
Tnrc6a	T	C	7: 123,192,613	F1785L	probably damaging	Het
Trio	A	T	15: 27,752,725	D2174E	probably benign	Het
Ttn	C	T	2: 76,793,256	V15326I	probably damaging	Het
Ubap2	T	A	4: 41,245,461		probably benign	Het
Vmn2r113	C	T	17: 22,958,347	P702S	probably damaging	Het
Vmn2r66	A	T	7: 85,007,772	W142R	probably damaging	Het
Vmn2r73	A	G	7: 85,870,374	Y459H	probably damaging	Het
Wsb2	C	T	5: 117,377,485	T385M	probably damaging	Het

Other mutations in Pde4d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Pde4d	APN	13	109936687	missense	possibly damaging	0.69
IGL00792:Pde4d	APN	13	109935395	missense	possibly damaging	0.85
IGL01014:Pde4d	APN	13	109949502	missense	probably damaging	1.00
IGL01660:Pde4d	APN	13	109938072	missense	probably damaging	1.00
IGL02233:Pde4d	APN	13	109740550	missense	probably damaging	1.00
IGL02405:Pde4d	APN	13	108860209	critical splice donor site	probably null
IGL02544:Pde4d	APN	13	109740523	missense	probably damaging	1.00
IGL02885:Pde4d	APN	13	109948261	missense	probably damaging	1.00
IGL03286:Pde4d	APN	13	109954506	unclassified	probably benign
IGL03406:Pde4d	APN	13	109954591	unclassified	probably benign
Heliosphere	UTSW	13	109116942	missense	probably benign
Stubbs	UTSW	13	109772722	intron	probably benign
IGL03055:Pde4d	UTSW	13	109935345	missense	probably damaging	1.00
R0020:Pde4d	UTSW	13	109954570	missense	possibly damaging	0.66
R0020:Pde4d	UTSW	13	109954570	missense	possibly damaging	0.66
R0054:Pde4d	UTSW	13	109740421	missense	probably benign	0.23
R0054:Pde4d	UTSW	13	109740421	missense	probably benign	0.23
R0357:Pde4d	UTSW	13	109951268	missense	possibly damaging	0.46
R0482:Pde4d	UTSW	13	109936710	missense	probably benign	0.00
R0689:Pde4d	UTSW	13	109740544	missense	possibly damaging	0.78
R0884:Pde4d	UTSW	13	109950940	missense	probably damaging	0.99
R1169:Pde4d	UTSW	13	109950928	splice site	probably null
R1225:Pde4d	UTSW	13	109950221	missense	probably benign	0.04
R1246:Pde4d	UTSW	13	109950973	missense	probably damaging	1.00
R1344:Pde4d	UTSW	13	109950387	nonsense	probably null
R1351:Pde4d	UTSW	13	109951275	missense	possibly damaging	0.46
R1371:Pde4d	UTSW	13	109117061	missense	probably benign	0.00
R1418:Pde4d	UTSW	13	109950387	nonsense	probably null
R2197:Pde4d	UTSW	13	109948390	missense	probably damaging	1.00
R2440:Pde4d	UTSW	13	109927197	intron	probably benign
R3114:Pde4d	UTSW	13	109948258	missense	probably damaging	1.00
R3115:Pde4d	UTSW	13	109948258	missense	probably damaging	1.00
R3722:Pde4d	UTSW	13	109951332	nonsense	probably null
R3742:Pde4d	UTSW	13	109740479	missense	probably benign	0.42
R3797:Pde4d	UTSW	13	109632897	missense	probably benign	0.29
R3983:Pde4d	UTSW	13	109740406	missense	probably benign	0.23
R4618:Pde4d	UTSW	13	109933877	missense	probably benign	0.13
R4768:Pde4d	UTSW	13	109933874	missense	probably damaging	1.00
R4795:Pde4d	UTSW	13	109938171	intron	probably benign
R4824:Pde4d	UTSW	13	109116866	missense	probably benign	0.00
R4984:Pde4d	UTSW	13	109740464	missense	probably damaging	1.00
R5180:Pde4d	UTSW	13	109740473	missense	probably benign	0.13
R5267:Pde4d	UTSW	13	109260809	intron	probably benign
R5311:Pde4d	UTSW	13	109632864	missense	probably benign	0.02
R5311:Pde4d	UTSW	13	109632865	missense	probably benign
R5376:Pde4d	UTSW	13	109772644	missense	probably benign	0.00
R5551:Pde4d	UTSW	13	109948396	critical splice donor site	probably null
R5753:Pde4d	UTSW	13	109772722	intron	probably benign
R5754:Pde4d	UTSW	13	109938013	missense	probably damaging	0.98
R5838:Pde4d	UTSW	13	109740442	missense	probably damaging	0.99
R5864:Pde4d	UTSW	13	109938048	missense	probably benign	0.00
R6039:Pde4d	UTSW	13	109948342	missense	probably damaging	1.00
R6039:Pde4d	UTSW	13	109948342	missense	probably damaging	1.00
R6049:Pde4d	UTSW	13	109032585	nonsense	probably null
R6214:Pde4d	UTSW	13	109949433	missense	probably damaging	1.00
R6215:Pde4d	UTSW	13	109949433	missense	probably damaging	1.00
R6273:Pde4d	UTSW	13	109950221	missense	possibly damaging	0.94
R6431:Pde4d	UTSW	13	109601786	splice site	probably null
R6501:Pde4d	UTSW	13	109116942	missense	probably benign
R6534:Pde4d	UTSW	13	109632901	missense	probably benign	0.05
R6709:Pde4d	UTSW	13	109948279	missense	probably damaging	1.00
R6722:Pde4d	UTSW	13	109632898	nonsense	probably null
R7164:Pde4d	UTSW	13	109032688	missense	probably benign
R7222:Pde4d	UTSW	13	109757579	missense	probably damaging	1.00
R7417:Pde4d	UTSW	13	109632788	splice site	probably null
R7489:Pde4d	UTSW	13	109116767	missense	unknown
R7563:Pde4d	UTSW	13	109951007	missense	probably benign	0.37
R7861:Pde4d	UTSW	13	109935324	missense	probably damaging	0.99
R8167:Pde4d	UTSW	13	109442321	missense	probably benign	0.00
R8197:Pde4d	UTSW	13	109948336	missense	probably damaging	1.00
R8469:Pde4d	UTSW	13	108860188	missense	probably benign
R8715:Pde4d	UTSW	13	109935342	missense	probably benign	0.29
R8926:Pde4d	UTSW	13	109938091	missense	probably benign	0.00
R9054:Pde4d	UTSW	13	109935390	missense	probably damaging	0.96
R9406:Pde4d	UTSW	13	109740530	missense	probably damaging	0.99
R9516:Pde4d	UTSW	13	109260662	missense
R9526:Pde4d	UTSW	13	109935381	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAATCACTGTCCCAGTCCAC -3'
(R):5'- AACTAGGCCACACGGATGAATG -3'

Sequencing Primer
(F):5'- CAGCATTTCGAAGTGCACATG -3'
(R):5'- CACACGGATGAATGAGACTTCCTTTG -3'

Posted On

2016-04-27