Incidental Mutation 'R4943:Map4k4'
ID383236
Institutional Source Beutler Lab
Gene Symbol Map4k4
Ensembl Gene ENSMUSG00000026074
Gene Namemitogen-activated protein kinase kinase kinase kinase 4
Synonyms9430080K19Rik, Nik
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location39900913-40026310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40019594 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1050 (I1050V)
Ref Sequence ENSEMBL: ENSMUSP00000126961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163854] [ENSMUST00000168431] [ENSMUST00000192509] [ENSMUST00000193682] [ENSMUST00000195259] [ENSMUST00000195636] [ENSMUST00000195860]
Predicted Effect probably damaging
Transcript: ENSMUST00000163854
AA Change: I1050V

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126961
Gene: ENSMUSG00000026074
AA Change: I1050V

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000168431
AA Change: I1000V
SMART Domains Protein: ENSMUSP00000129796
Gene: ENSMUSG00000026074
AA Change: I1000V

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191657
Predicted Effect unknown
Transcript: ENSMUST00000192509
AA Change: I996V
SMART Domains Protein: ENSMUSP00000141665
Gene: ENSMUSG00000026074
AA Change: I996V

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 633 644 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
low complexity region 700 709 N/A INTRINSIC
low complexity region 757 783 N/A INTRINSIC
low complexity region 837 850 N/A INTRINSIC
low complexity region 865 875 N/A INTRINSIC
CNH 916 1214 2.76e-127 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192884
Predicted Effect probably benign
Transcript: ENSMUST00000193682
AA Change: I983V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141862
Gene: ENSMUSG00000026074
AA Change: I983V

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 556 567 N/A INTRINSIC
low complexity region 590 616 N/A INTRINSIC
low complexity region 623 632 N/A INTRINSIC
low complexity region 680 706 N/A INTRINSIC
low complexity region 785 814 N/A INTRINSIC
low complexity region 824 837 N/A INTRINSIC
low complexity region 852 862 N/A INTRINSIC
CNH 903 1201 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195259
AA Change: I970V
SMART Domains Protein: ENSMUSP00000142056
Gene: ENSMUSG00000026074
AA Change: I970V

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 811 824 N/A INTRINSIC
low complexity region 839 849 N/A INTRINSIC
CNH 890 1188 2.76e-127 SMART
Predicted Effect unknown
Transcript: ENSMUST00000195636
AA Change: I1034V
SMART Domains Protein: ENSMUSP00000141613
Gene: ENSMUSG00000026074
AA Change: I1034V

DomainStartEndE-ValueType
S_TKc 25 289 3.4e-97 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 610 621 N/A INTRINSIC
low complexity region 644 670 N/A INTRINSIC
low complexity region 677 686 N/A INTRINSIC
low complexity region 731 757 N/A INTRINSIC
low complexity region 836 865 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
CNH 954 1252 1.4e-129 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195860
AA Change: I1050V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141400
Gene: ENSMUSG00000026074
AA Change: I1050V

DomainStartEndE-ValueType
S_TKc 25 289 6.87e-95 SMART
low complexity region 318 342 N/A INTRINSIC
coiled coil region 357 494 N/A INTRINSIC
low complexity region 503 512 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 721 747 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 811 837 N/A INTRINSIC
low complexity region 891 904 N/A INTRINSIC
low complexity region 919 929 N/A INTRINSIC
CNH 970 1268 2.76e-127 SMART
Meta Mutation Damage Score 0.3965 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. This kinase has been shown to specifically activate MAPK8/JNK. The activation of MAPK8 by this kinase is found to be inhibited by the dominant-negative mutants of MAP3K7/TAK1, MAP2K4/MKK4, and MAP2K7/MKK7, which suggests that this kinase may function through the MAP3K7-MAP2K4-MAP2K7 kinase cascade, and mediate the TNF-alpha signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around day E9.5-10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,245,327 T366K possibly damaging Het
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Ern2 C T 7: 122,173,258 R659H possibly damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nt5dc1 T C 10: 34,310,391 R58G probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr630 A T 7: 103,755,296 F96L probably benign Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rapgef2 A T 3: 79,064,547 S1494T probably benign Het
Rbms3 G C 9: 116,678,505 probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Zfp976 A T 7: 42,612,422 probably benign Het
Other mutations in Map4k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Map4k4 APN 1 40004816 missense probably damaging 0.99
IGL00417:Map4k4 APN 1 40014532 missense possibly damaging 0.92
IGL00516:Map4k4 APN 1 40014602 missense probably damaging 1.00
IGL01545:Map4k4 APN 1 40014229 splice site probably benign
IGL02092:Map4k4 APN 1 39986783 missense probably benign 0.12
IGL02092:Map4k4 APN 1 40024348 missense probably damaging 1.00
IGL02570:Map4k4 APN 1 39980579 missense probably benign 0.06
IGL02626:Map4k4 APN 1 40014097 splice site probably benign
IGL02993:Map4k4 APN 1 40014188 missense probably damaging 0.98
IGL03178:Map4k4 APN 1 39986693 missense possibly damaging 0.63
tank UTSW 1 40004864 missense possibly damaging 0.93
IGL02835:Map4k4 UTSW 1 40010600 missense probably damaging 0.99
R0496:Map4k4 UTSW 1 40006822 missense probably damaging 0.99
R0498:Map4k4 UTSW 1 39990178 missense probably benign 0.22
R0588:Map4k4 UTSW 1 40004864 missense possibly damaging 0.93
R0674:Map4k4 UTSW 1 40003815 missense probably damaging 1.00
R1205:Map4k4 UTSW 1 40003844 missense probably damaging 1.00
R1349:Map4k4 UTSW 1 40021159 missense probably damaging 1.00
R1615:Map4k4 UTSW 1 40006830 splice site probably benign
R1763:Map4k4 UTSW 1 40000757 splice site probably benign
R1800:Map4k4 UTSW 1 40023460 missense probably damaging 1.00
R1893:Map4k4 UTSW 1 40001557 missense probably benign 0.08
R2411:Map4k4 UTSW 1 40007496 missense probably damaging 0.96
R2851:Map4k4 UTSW 1 40000755 splice site probably benign
R2852:Map4k4 UTSW 1 40000755 splice site probably benign
R2987:Map4k4 UTSW 1 39986765 missense probably damaging 1.00
R3087:Map4k4 UTSW 1 40021082 critical splice acceptor site probably null
R3688:Map4k4 UTSW 1 39985171 splice site probably null
R4075:Map4k4 UTSW 1 40023462 missense probably damaging 0.96
R4304:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R4564:Map4k4 UTSW 1 39988975 missense probably damaging 1.00
R4569:Map4k4 UTSW 1 40000538 missense probably damaging 1.00
R4613:Map4k4 UTSW 1 40017191 missense probably benign 0.05
R4715:Map4k4 UTSW 1 40019564 missense probably damaging 1.00
R4788:Map4k4 UTSW 1 40003916 missense probably benign 0.01
R4926:Map4k4 UTSW 1 40017225 missense probably damaging 1.00
R5033:Map4k4 UTSW 1 40007502 missense probably damaging 0.99
R5177:Map4k4 UTSW 1 39986762 missense probably damaging 1.00
R5297:Map4k4 UTSW 1 39962217 missense probably damaging 1.00
R5844:Map4k4 UTSW 1 39999876 splice site probably benign
R5952:Map4k4 UTSW 1 39999922 unclassified probably benign
R6111:Map4k4 UTSW 1 40011662 missense probably benign 0.00
R6125:Map4k4 UTSW 1 40003965 missense possibly damaging 0.77
R6838:Map4k4 UTSW 1 39976722 missense probably damaging 1.00
R6927:Map4k4 UTSW 1 40011682 missense probably benign 0.00
R7008:Map4k4 UTSW 1 39988971 missense probably benign 0.44
R7164:Map4k4 UTSW 1 39973972 missense possibly damaging 0.74
R7195:Map4k4 UTSW 1 40019669 missense possibly damaging 0.93
R7352:Map4k4 UTSW 1 39962227 missense unknown
R7589:Map4k4 UTSW 1 40021091 nonsense probably null
R7816:Map4k4 UTSW 1 40014208 missense possibly damaging 0.53
R7869:Map4k4 UTSW 1 39974044 missense unknown
R8013:Map4k4 UTSW 1 39962212 missense unknown
R8145:Map4k4 UTSW 1 40000534 missense
R8154:Map4k4 UTSW 1 40021142 nonsense probably null
R8254:Map4k4 UTSW 1 40006675 missense probably damaging 0.99
R8266:Map4k4 UTSW 1 40011653 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TGCTTTTCCCAGATGGACTGTC -3'
(R):5'- TGAAGGACCTCCCAGCATAC -3'

Sequencing Primer
(F):5'- CAGATGGACTGTCTCTCTCAGAG -3'
(R):5'- TGCTGGTCACAGGACACCTC -3'
Posted On2016-04-27