Incidental Mutation 'R0333:F830045P16Rik'
ID38324
Institutional Source Beutler Lab
Gene Symbol F830045P16Rik
Ensembl Gene ENSMUSG00000043727
Gene NameRIKEN cDNA F830045P16 gene
SynonymsSirpb3
MMRRC Submission 038542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0333 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location129458359-129536602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129472857 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 167 (Y167H)
Ref Sequence ENSEMBL: ENSMUSP00000058047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050309]
Predicted Effect probably damaging
Transcript: ENSMUST00000050309
AA Change: Y167H

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058047
Gene: ENSMUSG00000043727
AA Change: Y167H

DomainStartEndE-ValueType
IG_like 51 123 7.95e-2 SMART
IGc1 156 227 5.66e-4 SMART
Pfam:C2-set_2 264 331 1.6e-6 PFAM
IGc1 359 432 2.28e-7 SMART
transmembrane domain 460 482 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 T C 9: 106,241,281 N214S probably benign Het
Antxr1 A G 6: 87,188,838 probably benign Het
Atxn7l3 A T 11: 102,294,992 probably null Het
Cab39l A G 14: 59,499,611 E60G probably damaging Het
Cdc5l G T 17: 45,393,216 probably benign Het
Cux2 T C 5: 121,860,608 E1423G probably benign Het
Dbndd1 G T 8: 123,506,773 Q165K probably damaging Het
Drd1 C A 13: 54,054,063 C37F probably damaging Het
Elp3 G A 14: 65,590,593 P11L probably benign Het
Gimap3 G A 6: 48,765,730 Q89* probably null Het
Herc1 G A 9: 66,464,699 probably null Het
Hist3h2a C A 11: 58,954,859 S41* probably null Het
Ipo11 A G 13: 106,870,763 V603A probably benign Het
Kifap3 G A 1: 163,797,264 A130T probably damaging Het
Klhl23 A G 2: 69,833,897 Y530C probably damaging Het
Map4k1 C T 7: 28,999,761 probably benign Het
Mroh2b T A 15: 4,931,118 L778M probably damaging Het
Mtdh T C 15: 34,118,101 S344P possibly damaging Het
Ncoa3 T G 2: 166,054,291 N371K probably damaging Het
Ncor2 C A 5: 125,034,344 probably benign Het
Nrn1l A G 8: 105,894,420 E48G probably benign Het
Nudcd1 A G 15: 44,401,287 I271T probably benign Het
Olfr23 A T 11: 73,940,767 I174F possibly damaging Het
Olfr31 T C 14: 14,328,498 L129P probably damaging Het
Pard3b A G 1: 62,230,212 N653S probably benign Het
Park2 T C 17: 11,067,140 F6L probably damaging Het
Plekhg1 A C 10: 3,964,419 K1380N probably damaging Het
Ppara T A 15: 85,790,960 I210N probably damaging Het
Ppp2r5b A G 19: 6,229,047 probably benign Het
Prr14l A G 5: 32,827,993 L1386P probably damaging Het
Ralgapa1 A G 12: 55,782,900 probably benign Het
Reln A T 5: 21,929,242 L2563I probably damaging Het
Rps7 A G 12: 28,631,201 probably benign Het
Rslcan18 T C 13: 67,098,622 K309E probably damaging Het
Sec14l5 C T 16: 5,167,066 T92M probably damaging Het
Slc22a8 G A 19: 8,608,150 probably benign Het
Smad2 G A 18: 76,262,621 A44T probably damaging Het
Smcr8 T C 11: 60,780,222 V732A possibly damaging Het
Spata2l A G 8: 123,233,632 F306S probably damaging Het
Stab2 T C 10: 86,841,627 D2552G probably benign Het
Tctn3 A T 19: 40,607,267 L358H possibly damaging Het
Tk2 C T 8: 104,248,514 probably benign Het
Tm6sf2 C T 8: 70,077,914 R215C probably damaging Het
Tmbim6 T C 15: 99,406,674 I204T probably damaging Het
Tubgcp2 C A 7: 139,999,347 W675C probably damaging Het
Usp48 T A 4: 137,594,483 I62N probably damaging Het
Vmn2r74 T C 7: 85,952,283 T716A probably benign Het
Vps13b C A 15: 35,879,803 T3008K probably damaging Het
Wnk1 G A 6: 119,928,163 probably benign Het
Other mutations in F830045P16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:F830045P16Rik APN 2 129460529 missense probably damaging 0.97
IGL01149:F830045P16Rik APN 2 129460312 critical splice donor site probably null
IGL01556:F830045P16Rik APN 2 129463720 missense probably benign 0.01
IGL01690:F830045P16Rik APN 2 129472694 missense probably damaging 1.00
IGL02169:F830045P16Rik APN 2 129463572 missense probably damaging 1.00
IGL03194:F830045P16Rik APN 2 129460320 missense possibly damaging 0.91
IGL03231:F830045P16Rik APN 2 129460473 missense probably damaging 1.00
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0062:F830045P16Rik UTSW 2 129463704 missense possibly damaging 0.94
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0234:F830045P16Rik UTSW 2 129463464 missense possibly damaging 0.85
R0479:F830045P16Rik UTSW 2 129472688 missense possibly damaging 0.86
R0550:F830045P16Rik UTSW 2 129463509 missense probably damaging 1.00
R0827:F830045P16Rik UTSW 2 129472776 missense probably benign 0.01
R1087:F830045P16Rik UTSW 2 129472719 missense possibly damaging 0.55
R1142:F830045P16Rik UTSW 2 129460332 nonsense probably null
R1642:F830045P16Rik UTSW 2 129463714 missense probably benign 0.00
R2022:F830045P16Rik UTSW 2 129472665 missense probably damaging 1.00
R2044:F830045P16Rik UTSW 2 129459397 missense possibly damaging 0.68
R4008:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4009:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4011:F830045P16Rik UTSW 2 129463547 missense probably damaging 1.00
R4212:F830045P16Rik UTSW 2 129460353 missense probably benign 0.00
R4579:F830045P16Rik UTSW 2 129463503 missense probably damaging 0.97
R4838:F830045P16Rik UTSW 2 129460550 missense possibly damaging 0.95
R5190:F830045P16Rik UTSW 2 129472715 missense probably benign 0.01
R5217:F830045P16Rik UTSW 2 129463573 missense probably damaging 1.00
R5297:F830045P16Rik UTSW 2 129460553 missense probably benign 0.10
R5352:F830045P16Rik UTSW 2 129472901 missense probably damaging 0.98
R6063:F830045P16Rik UTSW 2 129474390 missense probably damaging 1.00
R6072:F830045P16Rik UTSW 2 129472694 missense probably damaging 1.00
R6173:F830045P16Rik UTSW 2 129463668 missense probably damaging 1.00
R6383:F830045P16Rik UTSW 2 129536438 missense probably benign 0.04
R6386:F830045P16Rik UTSW 2 129472818 missense probably damaging 1.00
R6425:F830045P16Rik UTSW 2 129460580 missense probably damaging 1.00
R6699:F830045P16Rik UTSW 2 129460421 missense probably damaging 0.98
R6869:F830045P16Rik UTSW 2 129474561 missense probably damaging 0.99
R7751:F830045P16Rik UTSW 2 129460447 missense probably damaging 1.00
R8012:F830045P16Rik UTSW 2 129474432 missense possibly damaging 0.92
R8097:F830045P16Rik UTSW 2 129463585 missense possibly damaging 0.55
Z1176:F830045P16Rik UTSW 2 129536530 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTTAGCCACAATGCCCTGAGGAC -3'
(R):5'- ATCTGAGTGACCCTGAGACAGGTG -3'

Sequencing Primer
(F):5'- GGAAACAAGGCACTTACCTCTG -3'
(R):5'- CCCTGAGACAGGTGGATAAGTC -3'
Posted On2013-05-23