Incidental Mutation 'R4943:Rapgef2'
ID383247
Institutional Source Beutler Lab
Gene Symbol Rapgef2
Ensembl Gene ENSMUSG00000062232
Gene NameRap guanine nucleotide exchange factor (GEF) 2
SynonymsCNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location79062516-79286517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79064547 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1494 (S1494T)
Ref Sequence ENSEMBL: ENSMUSP00000114119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]
Predicted Effect probably benign
Transcript: ENSMUST00000118100
AA Change: S1494T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232
AA Change: S1494T

DomainStartEndE-ValueType
low complexity region 38 62 N/A INTRINSIC
low complexity region 84 95 N/A INTRINSIC
cNMP 135 253 2.48e-15 SMART
RasGEFN 267 380 1.3e-31 SMART
PDZ 395 467 1.28e-12 SMART
RA 606 692 7.59e-23 SMART
RasGEF 713 950 6.09e-100 SMART
low complexity region 1030 1046 N/A INTRINSIC
low complexity region 1110 1124 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
low complexity region 1392 1405 N/A INTRINSIC
low complexity region 1440 1455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118340
AA Change: S1492T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232
AA Change: S1492T

DomainStartEndE-ValueType
low complexity region 36 60 N/A INTRINSIC
low complexity region 82 93 N/A INTRINSIC
cNMP 133 251 2.48e-15 SMART
RasGEFN 265 378 1.3e-31 SMART
PDZ 393 465 1.28e-12 SMART
RA 604 690 7.59e-23 SMART
RasGEF 711 948 6.09e-100 SMART
low complexity region 1028 1044 N/A INTRINSIC
low complexity region 1108 1122 N/A INTRINSIC
low complexity region 1138 1159 N/A INTRINSIC
low complexity region 1390 1403 N/A INTRINSIC
low complexity region 1438 1453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195708
AA Change: S1642T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232
AA Change: S1642T

DomainStartEndE-ValueType
cNMP 24 131 3.9e-4 SMART
low complexity region 186 210 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
cNMP 283 401 1.2e-17 SMART
RasGEFN 415 528 6.4e-34 SMART
PDZ 543 615 6.4e-15 SMART
RA 754 840 4.8e-25 SMART
RasGEF 861 1098 3.8e-102 SMART
low complexity region 1178 1194 N/A INTRINSIC
low complexity region 1258 1272 N/A INTRINSIC
low complexity region 1288 1309 N/A INTRINSIC
low complexity region 1540 1553 N/A INTRINSIC
low complexity region 1588 1603 N/A INTRINSIC
Meta Mutation Damage Score 0.0912 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,245,327 T366K possibly damaging Het
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Ern2 C T 7: 122,173,258 R659H possibly damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Map4k4 A G 1: 40,019,594 I1050V probably damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nt5dc1 T C 10: 34,310,391 R58G probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr630 A T 7: 103,755,296 F96L probably benign Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rbms3 G C 9: 116,678,505 probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Zfp976 A T 7: 42,612,422 probably benign Het
Other mutations in Rapgef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rapgef2 APN 3 79092025 missense possibly damaging 0.89
IGL01024:Rapgef2 APN 3 79070138 missense probably benign 0.43
IGL01448:Rapgef2 APN 3 79068937 missense probably benign
IGL01448:Rapgef2 APN 3 79103962 critical splice donor site probably null
IGL01928:Rapgef2 APN 3 79103963 missense probably damaging 1.00
IGL01973:Rapgef2 APN 3 79091809 splice site probably null
IGL02015:Rapgef2 APN 3 79092064 splice site probably benign
IGL02498:Rapgef2 APN 3 79066753 missense probably damaging 0.97
IGL02631:Rapgef2 APN 3 79083226 missense possibly damaging 0.77
IGL02835:Rapgef2 APN 3 79092986 splice site probably benign
IGL02887:Rapgef2 APN 3 79068880 splice site probably benign
IGL03030:Rapgef2 APN 3 79074307 critical splice donor site probably null
IGL03035:Rapgef2 APN 3 79094424 missense probably damaging 1.00
IGL03222:Rapgef2 APN 3 79087995 missense probably damaging 1.00
IGL03227:Rapgef2 APN 3 79092613 splice site probably benign
IGL03326:Rapgef2 APN 3 79091833 missense probably damaging 0.96
IGL03335:Rapgef2 APN 3 79099185 missense probably damaging 1.00
IGL03384:Rapgef2 APN 3 79083546 missense probably damaging 1.00
Bulge UTSW 3 79079132 missense probably benign 0.01
Hai_phat UTSW 3 79085959 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0022:Rapgef2 UTSW 3 79087900 missense probably damaging 1.00
R0038:Rapgef2 UTSW 3 79069396 missense probably benign 0.00
R0117:Rapgef2 UTSW 3 79079177 missense probably benign 0.00
R0225:Rapgef2 UTSW 3 79104105 missense probably damaging 0.99
R0723:Rapgef2 UTSW 3 79079174 missense probably benign 0.20
R0788:Rapgef2 UTSW 3 79099195 missense possibly damaging 0.59
R1311:Rapgef2 UTSW 3 79083547 missense probably benign 0.12
R1374:Rapgef2 UTSW 3 79087968 missense probably benign 0.08
R1507:Rapgef2 UTSW 3 79081293 splice site probably benign
R1523:Rapgef2 UTSW 3 79092749 missense probably damaging 1.00
R1753:Rapgef2 UTSW 3 79088791 missense possibly damaging 0.65
R1759:Rapgef2 UTSW 3 79066731 missense possibly damaging 0.89
R1766:Rapgef2 UTSW 3 79092703 missense probably damaging 1.00
R2436:Rapgef2 UTSW 3 79088772 missense possibly damaging 0.95
R3033:Rapgef2 UTSW 3 79074306 critical splice donor site probably null
R3766:Rapgef2 UTSW 3 79088750 missense probably benign 0.01
R4118:Rapgef2 UTSW 3 79068887 critical splice donor site probably null
R4416:Rapgef2 UTSW 3 79069057 nonsense probably null
R4722:Rapgef2 UTSW 3 79069173 missense probably benign 0.00
R4743:Rapgef2 UTSW 3 79173068 missense probably damaging 0.99
R4780:Rapgef2 UTSW 3 79169769 splice site probably benign
R4825:Rapgef2 UTSW 3 79083227 missense probably benign 0.03
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4861:Rapgef2 UTSW 3 79074436 missense probably benign 0.01
R4900:Rapgef2 UTSW 3 79074363 missense probably benign 0.02
R5291:Rapgef2 UTSW 3 79070059 missense possibly damaging 0.64
R5369:Rapgef2 UTSW 3 79069432 missense probably benign 0.00
R5413:Rapgef2 UTSW 3 79087866 missense probably damaging 1.00
R5561:Rapgef2 UTSW 3 79088643 critical splice donor site probably null
R5568:Rapgef2 UTSW 3 79104001 missense probably damaging 1.00
R5642:Rapgef2 UTSW 3 79094850 missense probably damaging 1.00
R5783:Rapgef2 UTSW 3 79087993 missense probably benign 0.00
R6041:Rapgef2 UTSW 3 79069162 missense probably benign 0.00
R6193:Rapgef2 UTSW 3 79069444 missense possibly damaging 0.48
R6324:Rapgef2 UTSW 3 79079132 missense probably benign 0.01
R6551:Rapgef2 UTSW 3 79215035 splice site probably null
R6688:Rapgef2 UTSW 3 79069128 missense probably benign 0.03
R6908:Rapgef2 UTSW 3 79104063 missense probably benign 0.01
R6913:Rapgef2 UTSW 3 79085974 missense probably damaging 1.00
R6933:Rapgef2 UTSW 3 79085959 missense probably damaging 1.00
R7086:Rapgef2 UTSW 3 79086046 missense probably benign 0.08
R7106:Rapgef2 UTSW 3 79066608 missense probably benign
R7228:Rapgef2 UTSW 3 79069218 missense probably benign 0.03
R7242:Rapgef2 UTSW 3 79087903 nonsense probably null
R7257:Rapgef2 UTSW 3 79082627 missense probably damaging 0.99
R7322:Rapgef2 UTSW 3 79145823 start codon destroyed probably null 0.02
R7443:Rapgef2 UTSW 3 79081224 missense probably damaging 1.00
R7450:Rapgef2 UTSW 3 79173059 missense probably benign 0.01
R7472:Rapgef2 UTSW 3 79069273 missense probably benign 0.45
R7884:Rapgef2 UTSW 3 79066626 missense possibly damaging 0.49
R7954:Rapgef2 UTSW 3 79070147 nonsense probably null
R7957:Rapgef2 UTSW 3 79214969 missense probably benign 0.27
R8071:Rapgef2 UTSW 3 79093036 missense probably damaging 1.00
R8261:Rapgef2 UTSW 3 79086018 missense probably benign 0.34
R8268:Rapgef2 UTSW 3 79085956 missense probably benign 0.12
R8309:Rapgef2 UTSW 3 79083202 missense possibly damaging 0.65
R8505:Rapgef2 UTSW 3 79079042 nonsense probably null
R8783:Rapgef2 UTSW 3 79098344 missense probably damaging 1.00
R8897:Rapgef2 UTSW 3 79112259 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGGCAATTTCTTCACAG -3'
(R):5'- GGGTGCTGGAATTATGGACC -3'

Sequencing Primer
(F):5'- TCACAGTATTTCACATGCAAAGGGG -3'
(R):5'- CCAGTCTGGTCTACATATGGAG -3'
Posted On2016-04-27