Mutagenetix > Incidental Mutation

Incidental Mutation 'R4943:Rapgef2'

383247

Institutional Source

Beutler Lab

Gene Symbol

Rapgef2

Ensembl Gene

ENSMUSG00000062232

Gene Name

Rap guanine nucleotide exchange factor (GEF) 2

Synonyms

CNRasGEF, RA-GEF-1, Pdzgef1, nRapGEP, 5830453M24Rik

MMRRC Submission

042540-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4943 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79062516-79286517 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79064547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1494 (S1494T)

Ref Sequence

ENSEMBL: ENSMUSP00000114119 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118100] [ENSMUST00000118340] [ENSMUST00000195708]

AlphaFold

Q8CHG7

Predicted Effect

probably benign
Transcript: ENSMUST00000118100
AA Change: S1494T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000114119
Gene: ENSMUSG00000062232
AA Change: S1494T

Domain	Start	End	E-Value	Type
low complexity region	38	62	N/A	INTRINSIC
low complexity region	84	95	N/A	INTRINSIC
cNMP	135	253	2.48e-15	SMART
RasGEFN	267	380	1.3e-31	SMART
PDZ	395	467	1.28e-12	SMART
RA	606	692	7.59e-23	SMART
RasGEF	713	950	6.09e-100	SMART
low complexity region	1030	1046	N/A	INTRINSIC
low complexity region	1110	1124	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
low complexity region	1392	1405	N/A	INTRINSIC
low complexity region	1440	1455	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118340
AA Change: S1492T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113778
Gene: ENSMUSG00000062232
AA Change: S1492T

Domain	Start	End	E-Value	Type
low complexity region	36	60	N/A	INTRINSIC
low complexity region	82	93	N/A	INTRINSIC
cNMP	133	251	2.48e-15	SMART
RasGEFN	265	378	1.3e-31	SMART
PDZ	393	465	1.28e-12	SMART
RA	604	690	7.59e-23	SMART
RasGEF	711	948	6.09e-100	SMART
low complexity region	1028	1044	N/A	INTRINSIC
low complexity region	1108	1122	N/A	INTRINSIC
low complexity region	1138	1159	N/A	INTRINSIC
low complexity region	1390	1403	N/A	INTRINSIC
low complexity region	1438	1453	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195708
AA Change: S1642T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000141542
Gene: ENSMUSG00000062232
AA Change: S1642T

Domain	Start	End	E-Value	Type
cNMP	24	131	3.9e-4	SMART
low complexity region	186	210	N/A	INTRINSIC
low complexity region	232	243	N/A	INTRINSIC
cNMP	283	401	1.2e-17	SMART
RasGEFN	415	528	6.4e-34	SMART
PDZ	543	615	6.4e-15	SMART
RA	754	840	4.8e-25	SMART
RasGEF	861	1098	3.8e-102	SMART
low complexity region	1178	1194	N/A	INTRINSIC
low complexity region	1258	1272	N/A	INTRINSIC
low complexity region	1288	1309	N/A	INTRINSIC
low complexity region	1540	1553	N/A	INTRINSIC
low complexity region	1588	1603	N/A	INTRINSIC

Meta Mutation Damage Score

0.0912

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RAPGEF2, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for a null allele die at mid-gestation exhibiting growth arrest and defects in vascular development, neural tube closure and embryo turning. Homozygotes for another null allele show yolk sac vascular defects, impaired cell physiology and heart, primitive gut, liver and brain formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	A	13: 77,245,327	T366K	possibly damaging	Het
2510039O18Rik	T	A	4: 147,945,098	H508Q	probably damaging	Het
Actl9	G	A	17: 33,433,085	V40M	possibly damaging	Het
Aen	T	A	7: 78,902,361	V23E	probably damaging	Het
Agbl1	G	A	7: 76,420,016	R432K	probably benign	Het
Akap13	T	A	7: 75,749,240	F2689I	probably benign	Het
Arhgap45	A	G	10: 80,026,503	S475G	probably benign	Het
Atg7	A	C	6: 114,697,084	Q231P	probably benign	Het
Calr3	A	T	8: 72,431,377	V226D	probably benign	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Cops4	A	T	5: 100,547,426	M404L	probably benign	Het
Cpne4	A	T	9: 105,019,773	H375L	probably damaging	Het
D16Ertd472e	A	T	16: 78,575,989	V20D	probably damaging	Het
Dcun1d5	T	C	9: 7,186,844	F55L	possibly damaging	Het
Dhx8	T	A	11: 101,737,700	L93*	probably null	Het
Dtx4	A	G	19: 12,501,060	L53P	probably damaging	Het
Ern2	C	T	7: 122,173,258	R659H	possibly damaging	Het
Etl4	G	A	2: 20,807,281	A1392T	probably benign	Het
Fat2	T	C	11: 55,279,033	R2967G	probably benign	Het
Fat4	A	G	3: 38,980,173	D2658G	probably benign	Het
Ftsj3	A	G	11: 106,249,518	V808A	probably damaging	Het
Gm10447	A	T	11: 53,456,389	Y104*	probably null	Het
Gm27013	A	T	6: 130,676,200	C766*	probably null	Het
Gm438	T	A	4: 144,777,720	E287V	probably benign	Het
Gm5581	A	G	6: 131,167,125		noncoding transcript	Het
Gpr158	G	A	2: 21,827,157	V1023I	probably damaging	Het
Hectd2	T	G	19: 36,604,247		probably null	Het
Hmcn2	T	C	2: 31,335,492	Y138H	probably damaging	Het
Kif28	T	C	1: 179,713,951	I369V	probably benign	Het
Kif4-ps	C	T	12: 101,149,217		noncoding transcript	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Map3k20	G	A	2: 72,371,918	M164I	possibly damaging	Het
Map4k4	A	G	1: 40,019,594	I1050V	probably damaging	Het
Med23	T	A	10: 24,875,669	V133D	possibly damaging	Het
Mycn	A	T	12: 12,937,079	L439Q	probably damaging	Het
Myh2	G	T	11: 67,197,317	A1920S	probably damaging	Het
Myom3	T	C	4: 135,814,274	V1392A	possibly damaging	Het
Nktr	T	A	9: 121,719,954		probably benign	Het
Nme3	A	G	17: 24,896,723	K48E	probably damaging	Het
Nt5dc1	T	C	10: 34,310,391	R58G	probably damaging	Het
Nup205	A	G	6: 35,224,639	E1270G	probably damaging	Het
Olfr106-ps	G	T	17: 37,395,025	A162S	probably benign	Het
Olfr1509	C	G	14: 52,450,594	Y60*	probably null	Het
Olfr630	A	T	7: 103,755,296	F96L	probably benign	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pclo	T	C	5: 14,712,637	L3708P	unknown	Het
Pde4dip	A	T	3: 97,755,511	N590K	probably damaging	Het
Prokr1	A	C	6: 87,581,824	I193S	possibly damaging	Het
Pxdc1	C	A	13: 34,639,006		probably null	Het
Rbms3	G	C	9: 116,678,505		probably benign	Het
Reep3	T	A	10: 67,096,263		probably benign	Het
Rwdd2b	T	C	16: 87,434,534	K244R	possibly damaging	Het
Srrm2	T	C	17: 23,822,415	V2533A	possibly damaging	Het
Stab2	T	C	10: 86,954,162	Y580C	probably damaging	Het
Stac2	G	T	11: 98,041,572	S198R	probably benign	Het
Tdp2	T	A	13: 24,838,265	N222K	probably benign	Het
Tex21	A	G	12: 76,221,700	S103P	probably damaging	Het
Thbs1	A	T	2: 118,113,449	I183F	probably damaging	Het
Tm9sf1	T	C	14: 55,641,168	I256V	probably damaging	Het
Tmem207	C	T	16: 26,517,853	W50*	probably null	Het
Trpm2	C	A	10: 77,966,007	V75L	probably damaging	Het
Vmn1r227	A	T	17: 20,735,361		noncoding transcript	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r75	A	T	7: 86,165,497	S263T	probably damaging	Het
Wdr64	G	A	1: 175,720,316	V140I	probably benign	Het
Xpo4	T	C	14: 57,638,240	I145M	possibly damaging	Het
Zan	G	A	5: 137,457,890	T1336I	unknown	Het
Zdbf2	G	T	1: 63,302,914	V151F	possibly damaging	Het
Zfhx3	T	C	8: 108,948,317	S2000P	probably damaging	Het
Zfp65	T	A	13: 67,710,980	I12F	probably damaging	Het
Zfp703	C	A	8: 26,979,591	Q428K	probably benign	Het
Zfp947	A	C	17: 22,145,832	M287R	probably benign	Het
Zfp976	A	T	7: 42,612,422		probably benign	Het

Other mutations in Rapgef2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Rapgef2	APN	3	79092025	missense	possibly damaging	0.89
IGL01024:Rapgef2	APN	3	79070138	missense	probably benign	0.43
IGL01448:Rapgef2	APN	3	79068937	missense	probably benign
IGL01448:Rapgef2	APN	3	79103962	critical splice donor site	probably null
IGL01928:Rapgef2	APN	3	79103963	missense	probably damaging	1.00
IGL01973:Rapgef2	APN	3	79091809	splice site	probably null
IGL02015:Rapgef2	APN	3	79092064	splice site	probably benign
IGL02498:Rapgef2	APN	3	79066753	missense	probably damaging	0.97
IGL02631:Rapgef2	APN	3	79083226	missense	possibly damaging	0.77
IGL02835:Rapgef2	APN	3	79092986	splice site	probably benign
IGL02887:Rapgef2	APN	3	79068880	splice site	probably benign
IGL03030:Rapgef2	APN	3	79074307	critical splice donor site	probably null
IGL03035:Rapgef2	APN	3	79094424	missense	probably damaging	1.00
IGL03222:Rapgef2	APN	3	79087995	missense	probably damaging	1.00
IGL03227:Rapgef2	APN	3	79092613	splice site	probably benign
IGL03326:Rapgef2	APN	3	79091833	missense	probably damaging	0.96
IGL03335:Rapgef2	APN	3	79099185	missense	probably damaging	1.00
IGL03384:Rapgef2	APN	3	79083546	missense	probably damaging	1.00
Bulge	UTSW	3	79079132	missense	probably benign	0.01
Hai_phat	UTSW	3	79085959	missense	probably damaging	1.00
R0022:Rapgef2	UTSW	3	79087900	missense	probably damaging	1.00
R0022:Rapgef2	UTSW	3	79087900	missense	probably damaging	1.00
R0038:Rapgef2	UTSW	3	79069396	missense	probably benign	0.00
R0117:Rapgef2	UTSW	3	79079177	missense	probably benign	0.00
R0225:Rapgef2	UTSW	3	79104105	missense	probably damaging	0.99
R0723:Rapgef2	UTSW	3	79079174	missense	probably benign	0.20
R0788:Rapgef2	UTSW	3	79099195	missense	possibly damaging	0.59
R1311:Rapgef2	UTSW	3	79083547	missense	probably benign	0.12
R1374:Rapgef2	UTSW	3	79087968	missense	probably benign	0.08
R1507:Rapgef2	UTSW	3	79081293	splice site	probably benign
R1523:Rapgef2	UTSW	3	79092749	missense	probably damaging	1.00
R1753:Rapgef2	UTSW	3	79088791	missense	possibly damaging	0.65
R1759:Rapgef2	UTSW	3	79066731	missense	possibly damaging	0.89
R1766:Rapgef2	UTSW	3	79092703	missense	probably damaging	1.00
R2436:Rapgef2	UTSW	3	79088772	missense	possibly damaging	0.95
R3033:Rapgef2	UTSW	3	79074306	critical splice donor site	probably null
R3766:Rapgef2	UTSW	3	79088750	missense	probably benign	0.01
R4118:Rapgef2	UTSW	3	79068887	critical splice donor site	probably null
R4416:Rapgef2	UTSW	3	79069057	nonsense	probably null
R4722:Rapgef2	UTSW	3	79069173	missense	probably benign	0.00
R4743:Rapgef2	UTSW	3	79173068	missense	probably damaging	0.99
R4780:Rapgef2	UTSW	3	79169769	splice site	probably benign
R4825:Rapgef2	UTSW	3	79083227	missense	probably benign	0.03
R4861:Rapgef2	UTSW	3	79074436	missense	probably benign	0.01
R4861:Rapgef2	UTSW	3	79074436	missense	probably benign	0.01
R4900:Rapgef2	UTSW	3	79074363	missense	probably benign	0.02
R5291:Rapgef2	UTSW	3	79070059	missense	possibly damaging	0.64
R5369:Rapgef2	UTSW	3	79069432	missense	probably benign	0.00
R5413:Rapgef2	UTSW	3	79087866	missense	probably damaging	1.00
R5561:Rapgef2	UTSW	3	79088643	critical splice donor site	probably null
R5568:Rapgef2	UTSW	3	79104001	missense	probably damaging	1.00
R5642:Rapgef2	UTSW	3	79094850	missense	probably damaging	1.00
R5783:Rapgef2	UTSW	3	79087993	missense	probably benign	0.00
R6041:Rapgef2	UTSW	3	79069162	missense	probably benign	0.00
R6193:Rapgef2	UTSW	3	79069444	missense	possibly damaging	0.48
R6324:Rapgef2	UTSW	3	79079132	missense	probably benign	0.01
R6551:Rapgef2	UTSW	3	79215035	splice site	probably null
R6688:Rapgef2	UTSW	3	79069128	missense	probably benign	0.03
R6908:Rapgef2	UTSW	3	79104063	missense	probably benign	0.01
R6913:Rapgef2	UTSW	3	79085974	missense	probably damaging	1.00
R6933:Rapgef2	UTSW	3	79085959	missense	probably damaging	1.00
R7086:Rapgef2	UTSW	3	79086046	missense	probably benign	0.08
R7106:Rapgef2	UTSW	3	79066608	missense	probably benign
R7228:Rapgef2	UTSW	3	79069218	missense	probably benign	0.03
R7242:Rapgef2	UTSW	3	79087903	nonsense	probably null
R7257:Rapgef2	UTSW	3	79082627	missense	probably damaging	0.99
R7322:Rapgef2	UTSW	3	79145823	start codon destroyed	probably null	0.02
R7443:Rapgef2	UTSW	3	79081224	missense	probably damaging	1.00
R7450:Rapgef2	UTSW	3	79173059	missense	probably benign	0.01
R7472:Rapgef2	UTSW	3	79069273	missense	probably benign	0.45
R7884:Rapgef2	UTSW	3	79066626	missense	possibly damaging	0.49
R7954:Rapgef2	UTSW	3	79070147	nonsense	probably null
R7957:Rapgef2	UTSW	3	79214969	missense	probably benign	0.27
R8071:Rapgef2	UTSW	3	79093036	missense	probably damaging	1.00
R8261:Rapgef2	UTSW	3	79086018	missense	probably benign	0.34
R8268:Rapgef2	UTSW	3	79085956	missense	probably benign	0.12
R8309:Rapgef2	UTSW	3	79083202	missense	possibly damaging	0.65
R8505:Rapgef2	UTSW	3	79079042	nonsense	probably null
R8783:Rapgef2	UTSW	3	79098344	missense	probably damaging	1.00
R8897:Rapgef2	UTSW	3	79112259	missense	probably damaging	1.00
R8965:Rapgef2	UTSW	3	79092544	missense	probably damaging	1.00
R9028:Rapgef2	UTSW	3	79074344	missense	probably damaging	1.00
R9284:Rapgef2	UTSW	3	79092703	missense	probably damaging	1.00
R9371:Rapgef2	UTSW	3	79174993	missense	probably damaging	1.00
R9479:Rapgef2	UTSW	3	79112188	missense	probably damaging	1.00
R9493:Rapgef2	UTSW	3	79112188	missense	probably damaging	1.00
R9494:Rapgef2	UTSW	3	79112188	missense	probably damaging	1.00
R9500:Rapgef2	UTSW	3	79066786	missense	probably benign
R9657:Rapgef2	UTSW	3	79091884	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCCAGGGCAATTTCTTCACAG -3'
(R):5'- GGGTGCTGGAATTATGGACC -3'

Sequencing Primer
(F):5'- TCACAGTATTTCACATGCAAAGGGG -3'
(R):5'- CCAGTCTGGTCTACATATGGAG -3'

Posted On

2016-04-27