Incidental Mutation 'R4943:Zfp976'
ID383262
Institutional Source Beutler Lab
Gene Symbol Zfp976
Ensembl Gene ENSMUSG00000074158
Gene Namezinc finger protein 976
Synonyms9830147E19Rik
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location42609526-42642588 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 42612422 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098503] [ENSMUST00000187616]
Predicted Effect probably benign
Transcript: ENSMUST00000098503
SMART Domains Protein: ENSMUSP00000096105
Gene: ENSMUSG00000074158

DomainStartEndE-ValueType
KRAB 4 66 1.73e-18 SMART
ZnF_C2H2 131 153 7.78e-3 SMART
ZnF_C2H2 159 181 1.67e-2 SMART
ZnF_C2H2 187 209 5.9e-3 SMART
ZnF_C2H2 215 237 1.38e-3 SMART
ZnF_C2H2 243 265 8.94e-3 SMART
ZnF_C2H2 271 293 2.24e-3 SMART
ZnF_C2H2 299 321 1.03e-2 SMART
ZnF_C2H2 327 349 1.58e-3 SMART
ZnF_C2H2 355 377 7.9e-4 SMART
ZnF_C2H2 383 405 5.9e-3 SMART
ZnF_C2H2 411 433 2.57e-3 SMART
ZnF_C2H2 439 461 3.16e-3 SMART
ZnF_C2H2 467 489 1.26e-2 SMART
ZnF_C2H2 495 517 8.34e-3 SMART
ZnF_C2H2 523 545 3.63e-3 SMART
ZnF_C2H2 551 573 4.79e-3 SMART
ZnF_C2H2 579 601 9.73e-4 SMART
ZnF_C2H2 607 629 3.63e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107994
Predicted Effect probably benign
Transcript: ENSMUST00000187616
SMART Domains Protein: ENSMUSP00000141023
Gene: ENSMUSG00000074158

DomainStartEndE-ValueType
KRAB 3 65 7.4e-21 SMART
ZnF_C2H2 130 152 3.2e-5 SMART
ZnF_C2H2 158 180 7.1e-5 SMART
ZnF_C2H2 186 208 2.4e-5 SMART
ZnF_C2H2 214 236 5.7e-6 SMART
ZnF_C2H2 242 264 3.8e-5 SMART
ZnF_C2H2 270 292 9.7e-6 SMART
ZnF_C2H2 298 320 4.2e-5 SMART
ZnF_C2H2 326 348 6.6e-6 SMART
ZnF_C2H2 354 376 3.3e-6 SMART
ZnF_C2H2 382 404 2.5e-5 SMART
ZnF_C2H2 410 432 1e-5 SMART
ZnF_C2H2 438 460 1.3e-5 SMART
ZnF_C2H2 466 488 5.2e-5 SMART
ZnF_C2H2 494 516 3.6e-5 SMART
ZnF_C2H2 522 544 1.6e-5 SMART
ZnF_C2H2 550 572 2e-5 SMART
ZnF_C2H2 578 600 4e-6 SMART
ZnF_C2H2 606 628 1.5e-5 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,245,327 T366K possibly damaging Het
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Ern2 C T 7: 122,173,258 R659H possibly damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Map4k4 A G 1: 40,019,594 I1050V probably damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nt5dc1 T C 10: 34,310,391 R58G probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr630 A T 7: 103,755,296 F96L probably benign Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rapgef2 A T 3: 79,064,547 S1494T probably benign Het
Rbms3 G C 9: 116,678,505 probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Other mutations in Zfp976
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Zfp976 APN 7 42613685 missense unknown
IGL01102:Zfp976 APN 7 42613909 nonsense probably null
IGL01111:Zfp976 APN 7 42616287 missense probably damaging 0.99
IGL01628:Zfp976 APN 7 42612511 missense unknown
IGL02008:Zfp976 APN 7 42614232 splice site probably benign
IGL02548:Zfp976 APN 7 42612529 missense unknown
R0190:Zfp976 UTSW 7 42642524 start gained probably benign
R0685:Zfp976 UTSW 7 42613717 missense probably damaging 0.98
R1310:Zfp976 UTSW 7 42613186 missense probably damaging 1.00
R1353:Zfp976 UTSW 7 42616018 missense probably damaging 0.99
R1447:Zfp976 UTSW 7 42612599 missense possibly damaging 0.79
R1569:Zfp976 UTSW 7 42613382 missense probably damaging 1.00
R1702:Zfp976 UTSW 7 42616000 missense possibly damaging 0.86
R1829:Zfp976 UTSW 7 42616311 missense probably damaging 1.00
R1939:Zfp976 UTSW 7 42613681 missense unknown
R1978:Zfp976 UTSW 7 42613841 missense probably damaging 1.00
R1981:Zfp976 UTSW 7 42613622 missense probably damaging 0.99
R2160:Zfp976 UTSW 7 42613930 missense probably benign
R2192:Zfp976 UTSW 7 42613271 missense probably damaging 1.00
R3121:Zfp976 UTSW 7 42613514 missense probably damaging 1.00
R4210:Zfp976 UTSW 7 42616325 missense probably damaging 0.99
R4724:Zfp976 UTSW 7 42613033 missense possibly damaging 0.91
R5047:Zfp976 UTSW 7 42613419 nonsense probably null
R5071:Zfp976 UTSW 7 42612930 nonsense probably null
R5125:Zfp976 UTSW 7 42612501 splice site probably null
R5178:Zfp976 UTSW 7 42612501 splice site probably null
R5305:Zfp976 UTSW 7 42613478 missense probably benign 0.00
R5777:Zfp976 UTSW 7 42614080 missense probably benign 0.00
R6153:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R6694:Zfp976 UTSW 7 42614186 missense probably damaging 0.99
R7226:Zfp976 UTSW 7 42613260 nonsense probably null
R7479:Zfp976 UTSW 7 42613179 missense probably benign 0.01
R7561:Zfp976 UTSW 7 42616277 missense probably damaging 1.00
R8178:Zfp976 UTSW 7 42613535 missense probably benign 0.03
R8261:Zfp976 UTSW 7 42612701 missense unknown
R8715:Zfp976 UTSW 7 42613445 missense possibly damaging 0.89
R8921:Zfp976 UTSW 7 42613151 missense possibly damaging 0.57
Z1088:Zfp976 UTSW 7 42612760 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TATTCGAAAACACCTGGGCT -3'
(R):5'- TATCTTCGAATGCATGAAAGAACACA -3'

Sequencing Primer
(F):5'- CCTGGGCTGTGAAAAAGCTTTATCAC -3'
(R):5'- GTGGTAAAGCCTTTTCACATTCCAG -3'
Posted On2016-04-27