Incidental Mutation 'R4943:Olfr630'
ID383268
Institutional Source Beutler Lab
Gene Symbol Olfr630
Ensembl Gene ENSMUSG00000050281
Gene Nameolfactory receptor 630
SynonymsMOR17-1, GA_x6K02T2PBJ9-6483085-6482126
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location103753480-103757333 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 103755296 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 96 (F96L)
Ref Sequence ENSEMBL: ENSMUSP00000102493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106880]
Predicted Effect probably benign
Transcript: ENSMUST00000106880
AA Change: F96L

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102493
Gene: ENSMUSG00000050281
AA Change: F96L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 305 3.7e-8 PFAM
Pfam:7tm_1 43 294 8.4e-25 PFAM
Pfam:7tm_4 144 287 9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217072
Meta Mutation Damage Score 0.1033 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,245,327 T366K possibly damaging Het
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Ern2 C T 7: 122,173,258 R659H possibly damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Map4k4 A G 1: 40,019,594 I1050V probably damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nt5dc1 T C 10: 34,310,391 R58G probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rapgef2 A T 3: 79,064,547 S1494T probably benign Het
Rbms3 G C 9: 116,678,505 probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Zfp976 A T 7: 42,612,422 probably benign Het
Other mutations in Olfr630
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Olfr630 APN 7 103755006 missense probably damaging 1.00
IGL01111:Olfr630 APN 7 103755373 missense probably benign 0.07
IGL02456:Olfr630 APN 7 103755493 missense possibly damaging 0.94
IGL03173:Olfr630 APN 7 103754976 missense probably benign 0.00
R1104:Olfr630 UTSW 7 103754976 missense probably benign 0.00
R1507:Olfr630 UTSW 7 103755021 missense probably benign 0.00
R1695:Olfr630 UTSW 7 103754924 nonsense probably null
R1966:Olfr630 UTSW 7 103755168 missense probably damaging 1.00
R1971:Olfr630 UTSW 7 103755320 nonsense probably null
R2696:Olfr630 UTSW 7 103755528 missense probably damaging 0.96
R5622:Olfr630 UTSW 7 103755169 missense probably damaging 0.99
R6365:Olfr630 UTSW 7 103755195 missense probably benign 0.00
R7592:Olfr630 UTSW 7 103755072 missense probably damaging 1.00
R8146:Olfr630 UTSW 7 103755303 missense probably damaging 1.00
R8283:Olfr630 UTSW 7 103754812 missense possibly damaging 0.51
R8867:Olfr630 UTSW 7 103754686 nonsense probably null
R8875:Olfr630 UTSW 7 103755255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGAGCAGAGCAGCAGTTC -3'
(R):5'- GGCTATGAGGAATTTCATCACTGG -3'

Sequencing Primer
(F):5'- GAGCAGCAGTTCCAATCTTG -3'
(R):5'- GAGGAATTTCATCACTGGATTTCC -3'
Posted On2016-04-27