Incidental Mutation 'R4943:Ern2'
ID383269
Institutional Source Beutler Lab
Gene Symbol Ern2
Ensembl Gene ENSMUSG00000030866
Gene Nameendoplasmic reticulum (ER) to nucleus signalling 2
SynonymsIre1b
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location122169893-122186207 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 122173258 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 659 (R659H)
Ref Sequence ENSEMBL: ENSMUSP00000033153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033153] [ENSMUST00000033154] [ENSMUST00000206198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033153
AA Change: R659H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033153
Gene: ENSMUSG00000030866
AA Change: R659H

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
PQQ 33 64 5.5e-8 SMART
PQQ 115 147 4.7e-4 SMART
PQQ 148 180 6.1e-2 SMART
PQQ 192 223 6.2e-3 SMART
low complexity region 449 461 N/A INTRINSIC
S_TKc 508 768 2.5e-11 SMART
PUG 831 888 9e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033154
SMART Domains Protein: ENSMUSP00000033154
Gene: ENSMUSG00000030867

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 20 35 N/A INTRINSIC
S_TKc 53 305 7.36e-95 SMART
low complexity region 354 365 N/A INTRINSIC
Pfam:POLO_box 418 479 4.4e-24 PFAM
Pfam:POLO_box 516 583 3.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000206198
AA Change: R658H

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.2397 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
MGI Phenotype PHENOTYPE: Mice homozygous for disruption of this gene are generally normal but display an increased susceptibility to intestinal inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,245,327 T366K possibly damaging Het
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Map4k4 A G 1: 40,019,594 I1050V probably damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nt5dc1 T C 10: 34,310,391 R58G probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr630 A T 7: 103,755,296 F96L probably benign Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rapgef2 A T 3: 79,064,547 S1494T probably benign Het
Rbms3 G C 9: 116,678,505 probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Zfp976 A T 7: 42,612,422 probably benign Het
Other mutations in Ern2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ern2 APN 7 122170092 missense probably damaging 0.99
IGL01324:Ern2 APN 7 122183190 missense possibly damaging 0.88
IGL02185:Ern2 APN 7 122173375 splice site probably benign
IGL02738:Ern2 APN 7 122182899 missense probably damaging 0.99
IGL02750:Ern2 APN 7 122181406 splice site probably benign
IGL03247:Ern2 APN 7 122171671 missense probably benign 0.02
ernie UTSW 7 122171661 critical splice donor site probably null
Ernie2 UTSW 7 122180862 splice site probably benign
ernie3 UTSW 7 122173819 critical splice acceptor site probably null
R0165:Ern2 UTSW 7 122179779 missense probably benign 0.02
R0785:Ern2 UTSW 7 122171661 critical splice donor site probably null
R0801:Ern2 UTSW 7 122180862 splice site probably benign
R1345:Ern2 UTSW 7 122177770 missense probably damaging 1.00
R1649:Ern2 UTSW 7 122177400 missense probably damaging 1.00
R1747:Ern2 UTSW 7 122173819 critical splice acceptor site probably null
R1747:Ern2 UTSW 7 122173820 critical splice acceptor site probably null
R1846:Ern2 UTSW 7 122176536 missense probably benign 0.32
R1899:Ern2 UTSW 7 122183842 splice site probably benign
R1986:Ern2 UTSW 7 122171529 missense probably benign 0.06
R2055:Ern2 UTSW 7 122183945 missense possibly damaging 0.84
R2329:Ern2 UTSW 7 122173487 missense possibly damaging 0.82
R2351:Ern2 UTSW 7 122171508 missense probably damaging 0.97
R2894:Ern2 UTSW 7 122181587 missense possibly damaging 0.94
R3176:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3276:Ern2 UTSW 7 122180964 missense possibly damaging 0.89
R3945:Ern2 UTSW 7 122176530 missense probably benign 0.10
R4303:Ern2 UTSW 7 122177846 critical splice acceptor site probably null
R4874:Ern2 UTSW 7 122176587 missense probably benign 0.28
R5184:Ern2 UTSW 7 122179959 missense probably benign 0.03
R5629:Ern2 UTSW 7 122170166 missense probably damaging 1.00
R5770:Ern2 UTSW 7 122179907 missense possibly damaging 0.92
R6255:Ern2 UTSW 7 122173272 missense probably damaging 1.00
R6272:Ern2 UTSW 7 122176646 missense probably benign 0.05
R6277:Ern2 UTSW 7 122186107 missense probably benign
R6624:Ern2 UTSW 7 122177783 missense probably benign 0.00
R6940:Ern2 UTSW 7 122186146 missense probably benign 0.01
R7491:Ern2 UTSW 7 122170533 missense probably damaging 1.00
R7544:Ern2 UTSW 7 122173199 missense probably benign 0.06
R7555:Ern2 UTSW 7 122170241 missense probably damaging 1.00
R7843:Ern2 UTSW 7 122173708 missense probably damaging 1.00
R7926:Ern2 UTSW 7 122173708 missense probably damaging 1.00
R8281:Ern2 UTSW 7 122170260 missense probably damaging 1.00
R8321:Ern2 UTSW 7 122173208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGTCAGGAGCGGATGGTC -3'
(R):5'- AGGTACCGTCTTGCTTCCAG -3'

Sequencing Primer
(F):5'- GAGATGCTTTCTTCCCAAGGCAAG -3'
(R):5'- GTACCGTCTTGCTTCCAGTCCTTAG -3'
Posted On2016-04-27