Incidental Mutation 'R4943:Rbms3'
ID383276
Institutional Source Beutler Lab
Gene Symbol Rbms3
Ensembl Gene ENSMUSG00000039607
Gene NameRNA binding motif, single stranded interacting protein
Synonyms
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location116572746-117629913 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to C at 116678505 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044901] [ENSMUST00000068962] [ENSMUST00000111772] [ENSMUST00000111773] [ENSMUST00000164018] [ENSMUST00000173429] [ENSMUST00000174868]
Predicted Effect probably benign
Transcript: ENSMUST00000044901
SMART Domains Protein: ENSMUSP00000039706
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068962
SMART Domains Protein: ENSMUSP00000066735
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 384 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069095
Predicted Effect probably benign
Transcript: ENSMUST00000111772
SMART Domains Protein: ENSMUSP00000107402
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 385 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111773
SMART Domains Protein: ENSMUSP00000107403
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
low complexity region 401 411 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164018
SMART Domains Protein: ENSMUSP00000131371
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 76 98 N/A INTRINSIC
RRM 106 174 1.2e-17 SMART
RRM 185 257 1.49e-13 SMART
low complexity region 433 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172469
SMART Domains Protein: ENSMUSP00000134172
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
Pfam:RRM_1 1 50 9.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173429
SMART Domains Protein: ENSMUSP00000133900
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
Blast:RRM 1 50 2e-29 BLAST
PDB:1X5O|A 1 60 3e-31 PDB
SCOP:d1h6kx_ 1 62 4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174868
SMART Domains Protein: ENSMUSP00000133621
Gene: ENSMUSG00000039607

DomainStartEndE-ValueType
low complexity region 27 49 N/A INTRINSIC
RRM 57 125 1.2e-17 SMART
RRM 136 208 1.49e-13 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that belongs to the c-myc gene single-strand binding protein family. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. The encoded protein was isolated by virtue of its binding to an upstream element of the alpha2(I) collagen promoter. The observation that this protein localizes mostly in the cytoplasm suggests that it may be involved in a cytoplasmic function such as controlling RNA metabolism, rather than transcription. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,245,327 T366K possibly damaging Het
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Ern2 C T 7: 122,173,258 R659H possibly damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Map4k4 A G 1: 40,019,594 I1050V probably damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nt5dc1 T C 10: 34,310,391 R58G probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr630 A T 7: 103,755,296 F96L probably benign Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rapgef2 A T 3: 79,064,547 S1494T probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Zfp976 A T 7: 42,612,422 probably benign Het
Other mutations in Rbms3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Rbms3 APN 9 117110115 missense probably damaging 0.99
IGL01859:Rbms3 APN 9 116959538 missense probably damaging 1.00
IGL01962:Rbms3 APN 9 116695811 splice site probably benign
IGL03034:Rbms3 APN 9 117251811 utr 5 prime probably benign
PIT4810001:Rbms3 UTSW 9 117056793 missense probably damaging 0.98
R0862:Rbms3 UTSW 9 117629792 splice site probably benign
R0864:Rbms3 UTSW 9 117629792 splice site probably benign
R0939:Rbms3 UTSW 9 117109960 critical splice donor site probably null
R1796:Rbms3 UTSW 9 116719333 missense probably damaging 1.00
R1808:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R1826:Rbms3 UTSW 9 116822868 missense probably damaging 1.00
R2213:Rbms3 UTSW 9 116959466 critical splice donor site probably null
R3719:Rbms3 UTSW 9 116582862 missense probably benign 0.11
R3935:Rbms3 UTSW 9 116636391 missense probably damaging 1.00
R4270:Rbms3 UTSW 9 117056748 missense probably damaging 1.00
R4822:Rbms3 UTSW 9 116944373 intron probably benign
R5445:Rbms3 UTSW 9 117251785 missense possibly damaging 0.74
R5997:Rbms3 UTSW 9 116719389 missense probably damaging 1.00
R6848:Rbms3 UTSW 9 117251741 missense probably damaging 1.00
R6944:Rbms3 UTSW 9 117110105 missense probably damaging 0.99
R7205:Rbms3 UTSW 9 116586017 critical splice donor site probably null
R7419:Rbms3 UTSW 9 116822826 missense probably damaging 1.00
R8267:Rbms3 UTSW 9 117056755 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATGGAATCTACCCATGCGTC -3'
(R):5'- TTGATGCGTAGGTCCAGAGC -3'

Sequencing Primer
(F):5'- ATGCGTCCTCTTTCCTCAGTAGG -3'
(R):5'- TAGGTCCAGAGCACGTCATG -3'
Posted On2016-04-27