Mutagenetix > Incidental Mutations

Incidental Mutation 'R4943:Med23'

383278

Institutional Source

Beutler Lab

Gene Symbol

Med23

Ensembl Gene

ENSMUSG00000019984

Gene Name

mediator complex subunit 23

Synonyms

X83317, 3000002A17Rik, ESTM7, Crsp3, Sur2

MMRRC Submission

042540-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4943 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24869986-24913681 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 24875669 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 133 (V133D)

Ref Sequence

ENSEMBL: ENSMUSP00000135751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176313] [ENSMUST00000176502] [ENSMUST00000177232]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020159
AA Change: V160D

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: V160D

Domain	Start	End	E-Value	Type
Pfam:Med23	3	1310	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000092646
AA Change: V160D

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: V160D

Domain	Start	End	E-Value	Type
Pfam:Med23	4	1316	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176313
AA Change: V133D

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135751
Gene: ENSMUSG00000019984
AA Change: V133D

Domain	Start	End	E-Value	Type
Pfam:Med23	1	197	1.7e-75	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000176502

SMART Domains

Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984

Domain	Start	End	E-Value	Type
Pfam:Med23	1	95	8.7e-36	PFAM
Pfam:Med23	92	234	3.8e-63	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176827

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177175

Predicted Effect

probably benign
Transcript: ENSMUST00000177232

SMART Domains

Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

Domain	Start	End	E-Value	Type
Pfam:Med23	3	58	1.2e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177522

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

99% (81/82)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210408I21Rik	C	A	13: 77,245,327	T366K	possibly damaging	Het
2510039O18Rik	T	A	4: 147,945,098	H508Q	probably damaging	Het
Actl9	G	A	17: 33,433,085	V40M	possibly damaging	Het
Aen	T	A	7: 78,902,361	V23E	probably damaging	Het
Agbl1	G	A	7: 76,420,016	R432K	probably benign	Het
Akap13	T	A	7: 75,749,240	F2689I	probably benign	Het
Arhgap45	A	G	10: 80,026,503	S475G	probably benign	Het
Atg7	A	C	6: 114,697,084	Q231P	probably benign	Het
Calr3	A	T	8: 72,431,377	V226D	probably benign	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Cops4	A	T	5: 100,547,426	M404L	probably benign	Het
Cpne4	A	T	9: 105,019,773	H375L	probably damaging	Het
D16Ertd472e	A	T	16: 78,575,989	V20D	probably damaging	Het
Dcun1d5	T	C	9: 7,186,844	F55L	possibly damaging	Het
Dhx8	T	A	11: 101,737,700	L93*	probably null	Het
Dtx4	A	G	19: 12,501,060	L53P	probably damaging	Het
Ern2	C	T	7: 122,173,258	R659H	possibly damaging	Het
Etl4	G	A	2: 20,807,281	A1392T	probably benign	Het
Fat2	T	C	11: 55,279,033	R2967G	probably benign	Het
Fat4	A	G	3: 38,980,173	D2658G	probably benign	Het
Ftsj3	A	G	11: 106,249,518	V808A	probably damaging	Het
Gm10447	A	T	11: 53,456,389	Y104*	probably null	Het
Gm27013	A	T	6: 130,676,200	C766*	probably null	Het
Gm438	T	A	4: 144,777,720	E287V	probably benign	Het
Gm5581	A	G	6: 131,167,125		noncoding transcript	Het
Gpr158	G	A	2: 21,827,157	V1023I	probably damaging	Het
Hectd2	T	G	19: 36,604,247		probably null	Het
Hmcn2	T	C	2: 31,335,492	Y138H	probably damaging	Het
Kif28	T	C	1: 179,713,951	I369V	probably benign	Het
Kif4-ps	C	T	12: 101,149,217		noncoding transcript	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Map3k20	G	A	2: 72,371,918	M164I	possibly damaging	Het
Map4k4	A	G	1: 40,019,594	I1050V	probably damaging	Het
Mycn	A	T	12: 12,937,079	L439Q	probably damaging	Het
Myh2	G	T	11: 67,197,317	A1920S	probably damaging	Het
Myom3	T	C	4: 135,814,274	V1392A	possibly damaging	Het
Nktr	T	A	9: 121,719,954		probably benign	Het
Nme3	A	G	17: 24,896,723	K48E	probably damaging	Het
Nt5dc1	T	C	10: 34,310,391	R58G	probably damaging	Het
Nup205	A	G	6: 35,224,639	E1270G	probably damaging	Het
Olfr106-ps	G	T	17: 37,395,025	A162S	probably benign	Het
Olfr1509	C	G	14: 52,450,594	Y60*	probably null	Het
Olfr630	A	T	7: 103,755,296	F96L	probably benign	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pclo	T	C	5: 14,712,637	L3708P	unknown	Het
Pde4dip	A	T	3: 97,755,511	N590K	probably damaging	Het
Prokr1	A	C	6: 87,581,824	I193S	possibly damaging	Het
Pxdc1	C	A	13: 34,639,006		probably null	Het
Rapgef2	A	T	3: 79,064,547	S1494T	probably benign	Het
Rbms3	G	C	9: 116,678,505		probably benign	Het
Reep3	T	A	10: 67,096,263		probably benign	Het
Rwdd2b	T	C	16: 87,434,534	K244R	possibly damaging	Het
Srrm2	T	C	17: 23,822,415	V2533A	possibly damaging	Het
Stab2	T	C	10: 86,954,162	Y580C	probably damaging	Het
Stac2	G	T	11: 98,041,572	S198R	probably benign	Het
Tdp2	T	A	13: 24,838,265	N222K	probably benign	Het
Tex21	A	G	12: 76,221,700	S103P	probably damaging	Het
Thbs1	A	T	2: 118,113,449	I183F	probably damaging	Het
Tm9sf1	T	C	14: 55,641,168	I256V	probably damaging	Het
Tmem207	C	T	16: 26,517,853	W50*	probably null	Het
Trpm2	C	A	10: 77,966,007	V75L	probably damaging	Het
Vmn1r227	A	T	17: 20,735,361		noncoding transcript	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r75	A	T	7: 86,165,497	S263T	probably damaging	Het
Wdr64	G	A	1: 175,720,316	V140I	probably benign	Het
Xpo4	T	C	14: 57,638,240	I145M	possibly damaging	Het
Zan	G	A	5: 137,457,890	T1336I	unknown	Het
Zdbf2	G	T	1: 63,302,914	V151F	possibly damaging	Het
Zfhx3	T	C	8: 108,948,317	S2000P	probably damaging	Het
Zfp65	T	A	13: 67,710,980	I12F	probably damaging	Het
Zfp703	C	A	8: 26,979,591	Q428K	probably benign	Het
Zfp947	A	C	17: 22,145,832	M287R	probably benign	Het
Zfp976	A	T	7: 42,612,422		probably benign	Het

Other mutations in Med23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00670:Med23	APN	10	24888584	missense	probably damaging	1.00
IGL00792:Med23	APN	10	24877004	missense	possibly damaging	0.93
IGL01289:Med23	APN	10	24902121	missense	probably damaging	1.00
IGL01469:Med23	APN	10	24882597	missense	probably damaging	1.00
IGL01598:Med23	APN	10	24903798	missense	probably benign	0.34
IGL02324:Med23	APN	10	24897341	missense	probably damaging	0.98
IGL02381:Med23	APN	10	24900728	missense	possibly damaging	0.95
IGL02465:Med23	APN	10	24903743	missense	probably damaging	0.96
IGL02554:Med23	APN	10	24898575	critical splice donor site	probably null
IGL02683:Med23	APN	10	24870717	missense	probably benign	0.00
PIT4362001:Med23	UTSW	10	24874571	missense	probably benign	0.01
R0080:Med23	UTSW	10	24912817	missense	probably benign	0.33
R0125:Med23	UTSW	10	24900788	missense	probably damaging	1.00
R0311:Med23	UTSW	10	24897358	missense	possibly damaging	0.95
R0765:Med23	UTSW	10	24900710	missense	probably damaging	1.00
R1302:Med23	UTSW	10	24888422	splice site	probably null
R1456:Med23	UTSW	10	24903652	splice site	probably benign
R1514:Med23	UTSW	10	24892667	splice site	probably benign
R1774:Med23	UTSW	10	24903686	missense	probably damaging	1.00
R1851:Med23	UTSW	10	24910870	splice site	probably null
R1928:Med23	UTSW	10	24909812	missense	probably benign
R1975:Med23	UTSW	10	24910766	missense	probably benign	0.01
R2011:Med23	UTSW	10	24879755	missense	possibly damaging	0.63
R2266:Med23	UTSW	10	24874601	missense	probably benign	0.00
R2309:Med23	UTSW	10	24870688	missense	probably damaging	0.99
R2507:Med23	UTSW	10	24910813	missense	probably damaging	1.00
R2566:Med23	UTSW	10	24888575	missense	probably damaging	1.00
R3720:Med23	UTSW	10	24891120	missense	probably damaging	1.00
R3771:Med23	UTSW	10	24902201	missense	probably damaging	1.00
R3811:Med23	UTSW	10	24892592	nonsense	probably null
R3811:Med23	UTSW	10	24892593	splice site	probably null
R4305:Med23	UTSW	10	24904270	nonsense	probably null
R4323:Med23	UTSW	10	24870705	missense	probably benign	0.02
R4701:Med23	UTSW	10	24893648	missense	probably damaging	1.00
R4886:Med23	UTSW	10	24874683	critical splice donor site	probably null
R4925:Med23	UTSW	10	24910747	missense	probably damaging	1.00
R5207:Med23	UTSW	10	24895836	nonsense	probably null
R5749:Med23	UTSW	10	24888449	missense	possibly damaging	0.84
R5806:Med23	UTSW	10	24907221	missense	probably damaging	1.00
R5896:Med23	UTSW	10	24902145	missense	probably damaging	1.00
R5954:Med23	UTSW	10	24870483	splice site	probably benign
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6031:Med23	UTSW	10	24903748	nonsense	probably null
R6093:Med23	UTSW	10	24878443	missense	probably benign	0.16
R6107:Med23	UTSW	10	24906034	nonsense	probably null
R6356:Med23	UTSW	10	24888413	missense	probably damaging	0.98
R6393:Med23	UTSW	10	24873476	missense	possibly damaging	0.91
R6533:Med23	UTSW	10	24893620	missense	probably damaging	1.00
R6911:Med23	UTSW	10	24902181	missense	probably damaging	0.98
R6981:Med23	UTSW	10	24895824	missense	possibly damaging	0.92
R7085:Med23	UTSW	10	24870121	missense	probably damaging	1.00
R7215:Med23	UTSW	10	24888429	missense	probably benign
R7229:Med23	UTSW	10	24902004	missense	probably benign
R7489:Med23	UTSW	10	24904356	missense	probably damaging	1.00
R7530:Med23	UTSW	10	24905953	missense	probably benign	0.00
R7643:Med23	UTSW	10	24905965	missense	probably benign	0.01
R7653:Med23	UTSW	10	24904384	missense	probably damaging	1.00
R7764:Med23	UTSW	10	24909920	critical splice donor site	probably null
R7784:Med23	UTSW	10	24902448	missense	probably damaging	1.00
R8024:Med23	UTSW	10	24879683	missense	possibly damaging	0.74
R8182:Med23	UTSW	10	24912807	missense	probably benign
R8412:Med23	UTSW	10	24908734	missense	probably benign	0.01
R8874:Med23	UTSW	10	24895719	missense	possibly damaging	0.92
RF003:Med23	UTSW	10	24903785	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGACCTAGAAGCAGTGTATACTTC -3'
(R):5'- AACACAGGGCTATGGCATTGG -3'

Sequencing Primer
(F):5'- AGCAGTGTATACTTCTGACACCTGG -3'
(R):5'- AGGGTGCATGCCTGGCTTC -3'

Posted On

2016-04-27