Incidental Mutation 'R0333:Prr14l'
ID 38328
Institutional Source Beutler Lab
Gene Symbol Prr14l
Ensembl Gene ENSMUSG00000054280
Gene Name proline rich 14-like
Synonyms
MMRRC Submission 038542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R0333 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 32789820-32854256 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 32827993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 1386 (L1386P)
Ref Sequence ENSEMBL: ENSMUSP00000113259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120129] [ENSMUST00000144673] [ENSMUST00000155392]
AlphaFold E9Q7C4
Predicted Effect probably damaging
Transcript: ENSMUST00000120129
AA Change: L1386P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113259
Gene: ENSMUSG00000054280
AA Change: L1386P

DomainStartEndE-ValueType
low complexity region 720 731 N/A INTRINSIC
low complexity region 1433 1446 N/A INTRINSIC
low complexity region 1471 1480 N/A INTRINSIC
Pfam:Tantalus 1838 1895 2.9e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144673
SMART Domains Protein: ENSMUSP00000124923
Gene: ENSMUSG00000093574

DomainStartEndE-ValueType
Pfam:Tantalus 158 193 1.2e-15 PFAM
Pfam:PS_Dcarbxylase 332 575 2.1e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155392
AA Change: L229P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119569
Gene: ENSMUSG00000054280
AA Change: L229P

DomainStartEndE-ValueType
low complexity region 276 289 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
Meta Mutation Damage Score 0.6693 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 T C 9: 106,241,281 N214S probably benign Het
Antxr1 A G 6: 87,188,838 probably benign Het
Atxn7l3 A T 11: 102,294,992 probably null Het
Cab39l A G 14: 59,499,611 E60G probably damaging Het
Cdc5l G T 17: 45,393,216 probably benign Het
Cux2 T C 5: 121,860,608 E1423G probably benign Het
Dbndd1 G T 8: 123,506,773 Q165K probably damaging Het
Drd1 C A 13: 54,054,063 C37F probably damaging Het
Elp3 G A 14: 65,590,593 P11L probably benign Het
F830045P16Rik A G 2: 129,472,857 Y167H probably damaging Het
Gimap3 G A 6: 48,765,730 Q89* probably null Het
Herc1 G A 9: 66,464,699 probably null Het
Hist3h2a C A 11: 58,954,859 S41* probably null Het
Ipo11 A G 13: 106,870,763 V603A probably benign Het
Kifap3 G A 1: 163,797,264 A130T probably damaging Het
Klhl23 A G 2: 69,833,897 Y530C probably damaging Het
Map4k1 C T 7: 28,999,761 probably benign Het
Mroh2b T A 15: 4,931,118 L778M probably damaging Het
Mtdh T C 15: 34,118,101 S344P possibly damaging Het
Ncoa3 T G 2: 166,054,291 N371K probably damaging Het
Ncor2 C A 5: 125,034,344 probably benign Het
Nrn1l A G 8: 105,894,420 E48G probably benign Het
Nudcd1 A G 15: 44,401,287 I271T probably benign Het
Olfr23 A T 11: 73,940,767 I174F possibly damaging Het
Olfr31 T C 14: 14,328,498 L129P probably damaging Het
Pard3b A G 1: 62,230,212 N653S probably benign Het
Park2 T C 17: 11,067,140 F6L probably damaging Het
Plekhg1 A C 10: 3,964,419 K1380N probably damaging Het
Ppara T A 15: 85,790,960 I210N probably damaging Het
Ppp2r5b A G 19: 6,229,047 probably benign Het
Ralgapa1 A G 12: 55,782,900 probably benign Het
Reln A T 5: 21,929,242 L2563I probably damaging Het
Rps7 A G 12: 28,631,201 probably benign Het
Rslcan18 T C 13: 67,098,622 K309E probably damaging Het
Sec14l5 C T 16: 5,167,066 T92M probably damaging Het
Slc22a8 G A 19: 8,608,150 probably benign Het
Smad2 G A 18: 76,262,621 A44T probably damaging Het
Smcr8 T C 11: 60,780,222 V732A possibly damaging Het
Spata2l A G 8: 123,233,632 F306S probably damaging Het
Stab2 T C 10: 86,841,627 D2552G probably benign Het
Tctn3 A T 19: 40,607,267 L358H possibly damaging Het
Tk2 C T 8: 104,248,514 probably benign Het
Tm6sf2 C T 8: 70,077,914 R215C probably damaging Het
Tmbim6 T C 15: 99,406,674 I204T probably damaging Het
Tubgcp2 C A 7: 139,999,347 W675C probably damaging Het
Usp48 T A 4: 137,594,483 I62N probably damaging Het
Vmn2r74 T C 7: 85,952,283 T716A probably benign Het
Vps13b C A 15: 35,879,803 T3008K probably damaging Het
Wnk1 G A 6: 119,928,163 probably benign Het
Other mutations in Prr14l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Prr14l APN 5 32830676 missense probably benign 0.04
IGL00331:Prr14l APN 5 32831066 missense probably benign 0.02
IGL01571:Prr14l APN 5 32828806 missense probably benign 0.01
IGL01795:Prr14l APN 5 32831845 unclassified probably benign
IGL01929:Prr14l APN 5 32828243 missense probably benign 0.09
IGL01959:Prr14l APN 5 32830205 missense possibly damaging 0.84
IGL02139:Prr14l APN 5 32827532 missense probably damaging 1.00
IGL02321:Prr14l APN 5 32827807 missense probably benign 0.10
IGL02508:Prr14l APN 5 32830942 missense probably benign 0.01
IGL02551:Prr14l APN 5 32831484 missense probably damaging 1.00
IGL02585:Prr14l APN 5 32829484 missense possibly damaging 0.59
IGL02614:Prr14l APN 5 32830543 missense possibly damaging 0.76
IGL02808:Prr14l APN 5 32828182 missense possibly damaging 0.94
IGL02836:Prr14l APN 5 32831096 missense probably benign 0.42
IGL02952:Prr14l APN 5 32835670 missense unknown
IGL03034:Prr14l APN 5 32827438 missense possibly damaging 0.48
Polymer UTSW 5 32827145 missense probably benign 0.34
Postwar UTSW 5 32830684 missense probably benign 0.17
H8562:Prr14l UTSW 5 32793728 missense probably damaging 1.00
R0086:Prr14l UTSW 5 32831559 unclassified probably benign
R0149:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0361:Prr14l UTSW 5 32793641 missense probably damaging 1.00
R0416:Prr14l UTSW 5 32828717 missense probably benign 0.25
R0480:Prr14l UTSW 5 32829880 missense probably benign 0.02
R0511:Prr14l UTSW 5 32844216 intron probably benign
R0639:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0673:Prr14l UTSW 5 32828915 missense probably benign 0.02
R0743:Prr14l UTSW 5 32831194 missense possibly damaging 0.55
R0792:Prr14l UTSW 5 32828423 missense probably damaging 1.00
R1006:Prr14l UTSW 5 32829482 missense probably benign 0.00
R1342:Prr14l UTSW 5 32830260 missense probably damaging 1.00
R1433:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R1527:Prr14l UTSW 5 32827949 missense possibly damaging 0.75
R1704:Prr14l UTSW 5 32830282 missense probably benign 0.01
R1967:Prr14l UTSW 5 32844469 intron probably benign
R2129:Prr14l UTSW 5 32831828 unclassified probably benign
R2150:Prr14l UTSW 5 32830702 missense probably benign 0.14
R2318:Prr14l UTSW 5 32830078 missense probably benign 0.04
R2915:Prr14l UTSW 5 32829768 missense probably benign 0.04
R3551:Prr14l UTSW 5 32828619 splice site probably null
R3820:Prr14l UTSW 5 32828984 missense probably damaging 0.99
R3852:Prr14l UTSW 5 32830345 missense probably damaging 1.00
R4126:Prr14l UTSW 5 32828003 missense probably damaging 0.97
R4345:Prr14l UTSW 5 32828576 missense probably damaging 1.00
R4388:Prr14l UTSW 5 32829254 missense probably damaging 1.00
R4575:Prr14l UTSW 5 32793644 missense probably damaging 1.00
R4596:Prr14l UTSW 5 32829308 missense probably benign 0.01
R4690:Prr14l UTSW 5 32844156 intron probably benign
R4824:Prr14l UTSW 5 32844399 intron probably benign
R4868:Prr14l UTSW 5 32829937 missense probably benign 0.04
R4869:Prr14l UTSW 5 32828833 missense probably damaging 1.00
R5201:Prr14l UTSW 5 32830247 missense possibly damaging 0.52
R5328:Prr14l UTSW 5 32830021 missense probably benign 0.00
R5410:Prr14l UTSW 5 32827777 missense probably damaging 0.98
R5476:Prr14l UTSW 5 32844138 intron probably benign
R5623:Prr14l UTSW 5 32844508 intron probably benign
R5730:Prr14l UTSW 5 32793603 missense probably damaging 1.00
R5988:Prr14l UTSW 5 32830851 missense probably damaging 0.98
R6261:Prr14l UTSW 5 32829404 missense possibly damaging 0.46
R6283:Prr14l UTSW 5 32830264 missense probably benign 0.14
R6307:Prr14l UTSW 5 32827525 missense probably damaging 0.97
R6825:Prr14l UTSW 5 32828548 missense possibly damaging 0.86
R6862:Prr14l UTSW 5 32827759 missense probably damaging 1.00
R6880:Prr14l UTSW 5 32830867 missense probably benign 0.01
R6931:Prr14l UTSW 5 32830691 missense probably damaging 0.98
R7101:Prr14l UTSW 5 32829427 missense probably damaging 1.00
R7164:Prr14l UTSW 5 32829166 missense probably damaging 1.00
R7203:Prr14l UTSW 5 32827145 missense probably benign 0.34
R7211:Prr14l UTSW 5 32830087 missense probably damaging 0.98
R7305:Prr14l UTSW 5 32831101 missense probably benign 0.14
R7346:Prr14l UTSW 5 32830684 missense probably benign 0.17
R7395:Prr14l UTSW 5 32828638 missense probably benign 0.00
R7624:Prr14l UTSW 5 32829623 missense possibly damaging 0.54
R7649:Prr14l UTSW 5 32828245 missense probably benign 0.18
R7753:Prr14l UTSW 5 32827253 missense probably damaging 1.00
R7828:Prr14l UTSW 5 32844391 intron probably benign
R7898:Prr14l UTSW 5 32829966 missense probably benign 0.04
R8071:Prr14l UTSW 5 32831164 missense probably benign 0.02
R9052:Prr14l UTSW 5 32830134 nonsense probably null
R9136:Prr14l UTSW 5 32828736 missense
Predicted Primers PCR Primer
(F):5'- ATCCCGCCGACATCTAAGTTCCTG -3'
(R):5'- GCTTTGCTGGAGGTGACCGAATAC -3'

Sequencing Primer
(F):5'- TTGTCAGTCTGGAGGCAAG -3'
(R):5'- AATACACGGTGCCTTTGTGAC -3'
Posted On 2013-05-23