Incidental Mutation 'R4943:Stac2'
ID 383288
Institutional Source Beutler Lab
Gene Symbol Stac2
Ensembl Gene ENSMUSG00000017400
Gene Name SH3 and cysteine rich domain 2
Synonyms 24b2/STAC2, 24b2
MMRRC Submission 042540-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R4943 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 97927449-97944288 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 97932398 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 198 (S198R)
Ref Sequence ENSEMBL: ENSMUSP00000017544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017544]
AlphaFold Q8R1B0
Predicted Effect probably benign
Transcript: ENSMUST00000017544
AA Change: S198R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000017544
Gene: ENSMUSG00000017400
AA Change: S198R

DomainStartEndE-ValueType
low complexity region 63 81 N/A INTRINSIC
low complexity region 89 101 N/A INTRINSIC
C1 111 161 1.73e-5 SMART
low complexity region 219 236 N/A INTRINSIC
low complexity region 261 276 N/A INTRINSIC
SH3 292 347 1.92e-18 SMART
Blast:SH3 352 407 1e-19 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000131519
AA Change: S23R
SMART Domains Protein: ENSMUSP00000118164
Gene: ENSMUSG00000017400
AA Change: S23R

DomainStartEndE-ValueType
Pfam:STAC2_u1 6 115 1.8e-32 PFAM
low complexity region 146 157 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,393,446 (GRCm39) T366K possibly damaging Het
2510039O18Rik T A 4: 148,029,555 (GRCm39) H508Q probably damaging Het
Aadacl4fm5 T A 4: 144,504,290 (GRCm39) E287V probably benign Het
Actl9 G A 17: 33,652,059 (GRCm39) V40M possibly damaging Het
Aen T A 7: 78,552,109 (GRCm39) V23E probably damaging Het
Agbl1 G A 7: 76,069,764 (GRCm39) R432K probably benign Het
Akap13 T A 7: 75,398,988 (GRCm39) F2689I probably benign Het
Arhgap45 A G 10: 79,862,337 (GRCm39) S475G probably benign Het
Atg7 A C 6: 114,674,045 (GRCm39) Q231P probably benign Het
Calr3 A T 8: 73,185,221 (GRCm39) V226D probably benign Het
Cldn10 G A 14: 119,025,725 (GRCm39) G53S possibly damaging Het
Cops4 A T 5: 100,695,292 (GRCm39) M404L probably benign Het
Cpne4 A T 9: 104,896,972 (GRCm39) H375L probably damaging Het
D16Ertd472e A T 16: 78,372,877 (GRCm39) V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 (GRCm39) F55L possibly damaging Het
Dhx8 T A 11: 101,628,526 (GRCm39) L93* probably null Het
Dtx4 A G 19: 12,478,424 (GRCm39) L53P probably damaging Het
Ern2 C T 7: 121,772,481 (GRCm39) R659H possibly damaging Het
Etl4 G A 2: 20,812,092 (GRCm39) A1392T probably benign Het
Fat2 T C 11: 55,169,859 (GRCm39) R2967G probably benign Het
Fat4 A G 3: 39,034,322 (GRCm39) D2658G probably benign Het
Ftsj3 A G 11: 106,140,344 (GRCm39) V808A probably damaging Het
Gm10447 A T 11: 53,347,216 (GRCm39) Y104* probably null Het
Gm27013 A T 6: 130,653,163 (GRCm39) C766* probably null Het
Gm5581 A G 6: 131,144,088 (GRCm39) noncoding transcript Het
Gpr158 G A 2: 21,831,968 (GRCm39) V1023I probably damaging Het
Hectd2 T G 19: 36,581,647 (GRCm39) probably null Het
Hmcn2 T C 2: 31,225,504 (GRCm39) Y138H probably damaging Het
Kif28 T C 1: 179,541,516 (GRCm39) I369V probably benign Het
Kif4-ps C T 12: 101,115,476 (GRCm39) noncoding transcript Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Map3k20 G A 2: 72,202,262 (GRCm39) M164I possibly damaging Het
Map4k4 A G 1: 40,058,754 (GRCm39) I1050V probably damaging Het
Med23 T A 10: 24,751,567 (GRCm39) V133D possibly damaging Het
Mycn A T 12: 12,987,080 (GRCm39) L439Q probably damaging Het
Myh2 G T 11: 67,088,143 (GRCm39) A1920S probably damaging Het
Myom3 T C 4: 135,541,585 (GRCm39) V1392A possibly damaging Het
Nktr T A 9: 121,549,020 (GRCm39) probably benign Het
Nme3 A G 17: 25,115,697 (GRCm39) K48E probably damaging Het
Nt5dc1 T C 10: 34,186,387 (GRCm39) R58G probably damaging Het
Nup205 A G 6: 35,201,574 (GRCm39) E1270G probably damaging Het
Or12d16-ps1 G T 17: 37,705,916 (GRCm39) A162S probably benign Het
Or4e2 C G 14: 52,688,051 (GRCm39) Y60* probably null Het
Or51l4 A T 7: 103,404,503 (GRCm39) F96L probably benign Het
Or8c20 C T 9: 38,260,924 (GRCm39) H176Y probably damaging Het
Pclo T C 5: 14,762,651 (GRCm39) L3708P unknown Het
Pde4dip A T 3: 97,662,827 (GRCm39) N590K probably damaging Het
Prokr1 A C 6: 87,558,806 (GRCm39) I193S possibly damaging Het
Pxdc1 C A 13: 34,822,989 (GRCm39) probably null Het
Rapgef2 A T 3: 78,971,854 (GRCm39) S1494T probably benign Het
Rbms3 G C 9: 116,507,573 (GRCm39) probably benign Het
Reep3 T A 10: 66,932,042 (GRCm39) probably benign Het
Rwdd2b T C 16: 87,231,422 (GRCm39) K244R possibly damaging Het
Srrm2 T C 17: 24,041,389 (GRCm39) V2533A possibly damaging Het
Stab2 T C 10: 86,790,026 (GRCm39) Y580C probably damaging Het
Tdp2 T A 13: 25,022,248 (GRCm39) N222K probably benign Het
Tex21 A G 12: 76,268,474 (GRCm39) S103P probably damaging Het
Thbs1 A T 2: 117,943,930 (GRCm39) I183F probably damaging Het
Tm9sf1 T C 14: 55,878,625 (GRCm39) I256V probably damaging Het
Tmem207 C T 16: 26,336,603 (GRCm39) W50* probably null Het
Trpm2 C A 10: 77,801,841 (GRCm39) V75L probably damaging Het
Vmn1r227 A T 17: 20,955,623 (GRCm39) noncoding transcript Het
Vmn2r13 C A 5: 109,322,915 (GRCm39) V125L probably benign Het
Vmn2r75 A T 7: 85,814,705 (GRCm39) S263T probably damaging Het
Wdr64 G A 1: 175,547,882 (GRCm39) V140I probably benign Het
Xpo4 T C 14: 57,875,697 (GRCm39) I145M possibly damaging Het
Zan G A 5: 137,456,152 (GRCm39) T1336I unknown Het
Zdbf2 G T 1: 63,342,073 (GRCm39) V151F possibly damaging Het
Zfhx3 T C 8: 109,674,949 (GRCm39) S2000P probably damaging Het
Zfp65 T A 13: 67,859,099 (GRCm39) I12F probably damaging Het
Zfp703 C A 8: 27,469,619 (GRCm39) Q428K probably benign Het
Zfp947 A C 17: 22,364,813 (GRCm39) M287R probably benign Het
Zfp976 A T 7: 42,261,846 (GRCm39) probably benign Het
Other mutations in Stac2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Stac2 APN 11 97,932,005 (GRCm39) missense probably benign 0.00
IGL01148:Stac2 APN 11 97,934,387 (GRCm39) nonsense probably null
IGL01320:Stac2 APN 11 97,930,921 (GRCm39) splice site probably null
IGL01614:Stac2 APN 11 97,943,774 (GRCm39) missense probably benign 0.10
IGL01637:Stac2 APN 11 97,932,180 (GRCm39) missense probably benign 0.00
IGL02797:Stac2 APN 11 97,934,345 (GRCm39) missense possibly damaging 0.92
IGL03025:Stac2 APN 11 97,934,548 (GRCm39) missense probably damaging 0.97
IGL03386:Stac2 APN 11 97,931,966 (GRCm39) missense possibly damaging 0.52
R0699:Stac2 UTSW 11 97,933,611 (GRCm39) missense possibly damaging 0.92
R1664:Stac2 UTSW 11 97,933,420 (GRCm39) missense probably damaging 1.00
R1799:Stac2 UTSW 11 97,930,444 (GRCm39) critical splice donor site probably null
R1868:Stac2 UTSW 11 97,943,771 (GRCm39) missense probably benign 0.00
R4731:Stac2 UTSW 11 97,930,521 (GRCm39) missense probably damaging 1.00
R4748:Stac2 UTSW 11 97,932,198 (GRCm39) missense possibly damaging 0.59
R4955:Stac2 UTSW 11 97,934,374 (GRCm39) missense possibly damaging 0.69
R5171:Stac2 UTSW 11 97,934,324 (GRCm39) missense possibly damaging 0.75
R7345:Stac2 UTSW 11 97,933,439 (GRCm39) missense probably damaging 1.00
R7527:Stac2 UTSW 11 97,930,452 (GRCm39) missense probably damaging 1.00
R7963:Stac2 UTSW 11 97,932,403 (GRCm39) missense probably benign
R7982:Stac2 UTSW 11 97,933,379 (GRCm39) missense probably benign
R8878:Stac2 UTSW 11 97,932,373 (GRCm39) missense probably benign 0.00
R9790:Stac2 UTSW 11 97,934,449 (GRCm39) missense probably benign 0.02
R9791:Stac2 UTSW 11 97,934,449 (GRCm39) missense probably benign 0.02
Z1176:Stac2 UTSW 11 97,934,393 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACTCTGGGGAGAAACAGG -3'
(R):5'- AGTCTAGAGCTCTATGAGACACTG -3'

Sequencing Primer
(F):5'- ACAGGAGGAGGATCAGCCCC -3'
(R):5'- GCTCTATGAGACACTGTCTTAAACC -3'
Posted On 2016-04-27