Mutagenetix > Incidental Mutation

Incidental Mutation 'R4943:2210408I21Rik'

383295

Institutional Source

Beutler Lab

Gene Symbol

2210408I21Rik

Ensembl Gene

ENSMUSG00000071252

Gene Name

RIKEN cDNA 2210408I21 gene

Synonyms

MMRRC Submission

042540-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4943 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77135540-77613784 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 77245327 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 366 (T366K)

Ref Sequence

ENSEMBL: ENSMUSP00000127449 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168779] [ENSMUST00000225760]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168779
AA Change: T366K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252
AA Change: T366K

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	151	164	N/A	INTRINSIC
Pfam:DUF4495	515	832	1.6e-140	PFAM
low complexity region	1241	1255	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000225760

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

99% (81/82)

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	A	4: 147,945,098	H508Q	probably damaging	Het
Actl9	G	A	17: 33,433,085	V40M	possibly damaging	Het
Aen	T	A	7: 78,902,361	V23E	probably damaging	Het
Agbl1	G	A	7: 76,420,016	R432K	probably benign	Het
Akap13	T	A	7: 75,749,240	F2689I	probably benign	Het
Arhgap45	A	G	10: 80,026,503	S475G	probably benign	Het
Atg7	A	C	6: 114,697,084	Q231P	probably benign	Het
Calr3	A	T	8: 72,431,377	V226D	probably benign	Het
Cldn10	G	A	14: 118,788,313	G53S	possibly damaging	Het
Cops4	A	T	5: 100,547,426	M404L	probably benign	Het
Cpne4	A	T	9: 105,019,773	H375L	probably damaging	Het
D16Ertd472e	A	T	16: 78,575,989	V20D	probably damaging	Het
Dcun1d5	T	C	9: 7,186,844	F55L	possibly damaging	Het
Dhx8	T	A	11: 101,737,700	L93*	probably null	Het
Dtx4	A	G	19: 12,501,060	L53P	probably damaging	Het
Ern2	C	T	7: 122,173,258	R659H	possibly damaging	Het
Etl4	G	A	2: 20,807,281	A1392T	probably benign	Het
Fat2	T	C	11: 55,279,033	R2967G	probably benign	Het
Fat4	A	G	3: 38,980,173	D2658G	probably benign	Het
Ftsj3	A	G	11: 106,249,518	V808A	probably damaging	Het
Gm10447	A	T	11: 53,456,389	Y104*	probably null	Het
Gm27013	A	T	6: 130,676,200	C766*	probably null	Het
Gm438	T	A	4: 144,777,720	E287V	probably benign	Het
Gm5581	A	G	6: 131,167,125		noncoding transcript	Het
Gpr158	G	A	2: 21,827,157	V1023I	probably damaging	Het
Hectd2	T	G	19: 36,604,247		probably null	Het
Hmcn2	T	C	2: 31,335,492	Y138H	probably damaging	Het
Kif28	T	C	1: 179,713,951	I369V	probably benign	Het
Kif4-ps	C	T	12: 101,149,217		noncoding transcript	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Map3k20	G	A	2: 72,371,918	M164I	possibly damaging	Het
Map4k4	A	G	1: 40,019,594	I1050V	probably damaging	Het
Med23	T	A	10: 24,875,669	V133D	possibly damaging	Het
Mycn	A	T	12: 12,937,079	L439Q	probably damaging	Het
Myh2	G	T	11: 67,197,317	A1920S	probably damaging	Het
Myom3	T	C	4: 135,814,274	V1392A	possibly damaging	Het
Nktr	T	A	9: 121,719,954		probably benign	Het
Nme3	A	G	17: 24,896,723	K48E	probably damaging	Het
Nt5dc1	T	C	10: 34,310,391	R58G	probably damaging	Het
Nup205	A	G	6: 35,224,639	E1270G	probably damaging	Het
Olfr106-ps	G	T	17: 37,395,025	A162S	probably benign	Het
Olfr1509	C	G	14: 52,450,594	Y60*	probably null	Het
Olfr630	A	T	7: 103,755,296	F96L	probably benign	Het
Olfr898	C	T	9: 38,349,628	H176Y	probably damaging	Het
Pclo	T	C	5: 14,712,637	L3708P	unknown	Het
Pde4dip	A	T	3: 97,755,511	N590K	probably damaging	Het
Prokr1	A	C	6: 87,581,824	I193S	possibly damaging	Het
Pxdc1	C	A	13: 34,639,006		probably null	Het
Rapgef2	A	T	3: 79,064,547	S1494T	probably benign	Het
Rbms3	G	C	9: 116,678,505		probably benign	Het
Reep3	T	A	10: 67,096,263		probably benign	Het
Rwdd2b	T	C	16: 87,434,534	K244R	possibly damaging	Het
Srrm2	T	C	17: 23,822,415	V2533A	possibly damaging	Het
Stab2	T	C	10: 86,954,162	Y580C	probably damaging	Het
Stac2	G	T	11: 98,041,572	S198R	probably benign	Het
Tdp2	T	A	13: 24,838,265	N222K	probably benign	Het
Tex21	A	G	12: 76,221,700	S103P	probably damaging	Het
Thbs1	A	T	2: 118,113,449	I183F	probably damaging	Het
Tm9sf1	T	C	14: 55,641,168	I256V	probably damaging	Het
Tmem207	C	T	16: 26,517,853	W50*	probably null	Het
Trpm2	C	A	10: 77,966,007	V75L	probably damaging	Het
Vmn1r227	A	T	17: 20,735,361		noncoding transcript	Het
Vmn2r13	C	A	5: 109,175,049	V125L	probably benign	Het
Vmn2r75	A	T	7: 86,165,497	S263T	probably damaging	Het
Wdr64	G	A	1: 175,720,316	V140I	probably benign	Het
Xpo4	T	C	14: 57,638,240	I145M	possibly damaging	Het
Zan	G	A	5: 137,457,890	T1336I	unknown	Het
Zdbf2	G	T	1: 63,302,914	V151F	possibly damaging	Het
Zfhx3	T	C	8: 108,948,317	S2000P	probably damaging	Het
Zfp65	T	A	13: 67,710,980	I12F	probably damaging	Het
Zfp703	C	A	8: 26,979,591	Q428K	probably benign	Het
Zfp947	A	C	17: 22,145,832	M287R	probably benign	Het
Zfp976	A	T	7: 42,612,422		probably benign	Het

Other mutations in 2210408I21Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:2210408I21Rik	APN	13	77323358	splice site	probably benign
IGL01154:2210408I21Rik	APN	13	77281094	missense	probably benign	0.01
IGL01461:2210408I21Rik	APN	13	77281095	missense	probably benign	0.25
IGL01624:2210408I21Rik	APN	13	77193086	missense	probably damaging	0.99
IGL02033:2210408I21Rik	APN	13	77259876	missense	possibly damaging	0.90
IGL02621:2210408I21Rik	APN	13	77260031	missense	possibly damaging	0.92
IGL02718:2210408I21Rik	APN	13	77174872	missense	probably damaging	1.00
IGL02823:2210408I21Rik	APN	13	77261955	missense	probably damaging	0.96
IGL02859:2210408I21Rik	APN	13	77267699	missense	possibly damaging	0.71
IGL03006:2210408I21Rik	APN	13	77323772	critical splice donor site	probably null
IGL03072:2210408I21Rik	APN	13	77259997	missense	probably benign
IGL03184:2210408I21Rik	APN	13	77323451	missense	possibly damaging	0.63
IGL03275:2210408I21Rik	APN	13	77298555	missense	possibly damaging	0.71
PIT4651001:2210408I21Rik	UTSW	13	77259895	missense	probably benign
R0226:2210408I21Rik	UTSW	13	77303425	missense	possibly damaging	0.86
R0323:2210408I21Rik	UTSW	13	77298555	missense	possibly damaging	0.71
R0614:2210408I21Rik	UTSW	13	77192663	missense	probably benign	0.26
R0894:2210408I21Rik	UTSW	13	77323607	missense	probably benign	0.18
R1165:2210408I21Rik	UTSW	13	77334287	missense	probably benign	0.06
R1509:2210408I21Rik	UTSW	13	77192647	missense	probably benign
R1711:2210408I21Rik	UTSW	13	77269920	missense	possibly damaging	0.93
R1714:2210408I21Rik	UTSW	13	77316360	missense	possibly damaging	0.86
R1718:2210408I21Rik	UTSW	13	77245370	intron	probably benign
R1836:2210408I21Rik	UTSW	13	77323374	missense	probably benign	0.00
R1893:2210408I21Rik	UTSW	13	77267809	missense	possibly damaging	0.93
R2035:2210408I21Rik	UTSW	13	77612642	makesense	probably null
R2329:2210408I21Rik	UTSW	13	77303325	missense	probably benign	0.04
R2897:2210408I21Rik	UTSW	13	77323521	missense	probably benign	0.33
R3688:2210408I21Rik	UTSW	13	77267849	missense	possibly damaging	0.52
R4153:2210408I21Rik	UTSW	13	77193173	missense	probably benign	0.00
R4387:2210408I21Rik	UTSW	13	77316574	critical splice donor site	probably null
R4388:2210408I21Rik	UTSW	13	77316574	critical splice donor site	probably null
R4499:2210408I21Rik	UTSW	13	77316527	missense	possibly damaging	0.96
R4614:2210408I21Rik	UTSW	13	77254256	splice site	probably null
R4798:2210408I21Rik	UTSW	13	77323724	missense	possibly damaging	0.96
R5045:2210408I21Rik	UTSW	13	77267808	splice site	probably null
R5387:2210408I21Rik	UTSW	13	77259973	missense	probably benign	0.11
R5500:2210408I21Rik	UTSW	13	77303389	missense	probably benign	0.33
R5686:2210408I21Rik	UTSW	13	77303314	missense	possibly damaging	0.72
R6111:2210408I21Rik	UTSW	13	77327902	missense	possibly damaging	0.72
R6135:2210408I21Rik	UTSW	13	77254216	missense	probably damaging	0.98
R6188:2210408I21Rik	UTSW	13	77183731	missense	possibly damaging	0.53
R6388:2210408I21Rik	UTSW	13	77262111	missense	probably benign
R6588:2210408I21Rik	UTSW	13	77192647	missense	probably benign
R6632:2210408I21Rik	UTSW	13	77281067	missense	possibly damaging	0.86
R6638:2210408I21Rik	UTSW	13	77303402	missense	probably benign	0.07
R6755:2210408I21Rik	UTSW	13	77327875	missense	probably benign
R6971:2210408I21Rik	UTSW	13	77193187	missense	possibly damaging	0.90
R7079:2210408I21Rik	UTSW	13	77254204	missense	possibly damaging	0.86
R7130:2210408I21Rik	UTSW	13	77269902	missense	possibly damaging	0.93
R7215:2210408I21Rik	UTSW	13	77323571	missense	possibly damaging	0.96
R7272:2210408I21Rik	UTSW	13	77323536	missense	probably benign	0.00
R7331:2210408I21Rik	UTSW	13	77183609	missense	possibly damaging	0.53
R7561:2210408I21Rik	UTSW	13	77193195	missense	probably benign
R7684:2210408I21Rik	UTSW	13	77612540	nonsense	probably null
R7728:2210408I21Rik	UTSW	13	77316477	missense	possibly damaging	0.96
R7881:2210408I21Rik	UTSW	13	77323566	missense	possibly damaging	0.53
R7963:2210408I21Rik	UTSW	13	77192554	missense	probably benign	0.02
R8008:2210408I21Rik	UTSW	13	77281115	missense	probably benign	0.28
R8024:2210408I21Rik	UTSW	13	77612594	missense	probably benign
R8170:2210408I21Rik	UTSW	13	77263594	missense	probably benign	0.06
R8201:2210408I21Rik	UTSW	13	77193159	missense	possibly damaging	0.72
R8255:2210408I21Rik	UTSW	13	77267731	missense	possibly damaging	0.71
R8296:2210408I21Rik	UTSW	13	77267777	missense	probably damaging	0.98
R8476:2210408I21Rik	UTSW	13	77261901	missense	possibly damaging	0.92
R8526:2210408I21Rik	UTSW	13	77269816	nonsense	probably null
R8746:2210408I21Rik	UTSW	13	77303410	missense	probably benign	0.01
R8812:2210408I21Rik	UTSW	13	77332352	missense	probably damaging	0.98
R8870:2210408I21Rik	UTSW	13	77323721	missense	possibly damaging	0.96
R8885:2210408I21Rik	UTSW	13	77323406	missense	possibly damaging	0.91
R8910:2210408I21Rik	UTSW	13	77323649	missense	probably benign	0.03
R8911:2210408I21Rik	UTSW	13	77281115	missense	probably benign	0.28
R8965:2210408I21Rik	UTSW	13	77612604	missense	probably benign	0.02
R8968:2210408I21Rik	UTSW	13	77332310	nonsense	probably null
R8989:2210408I21Rik	UTSW	13	77612605	missense	probably benign	0.01
R9163:2210408I21Rik	UTSW	13	77245281	missense	possibly damaging	0.73
R9378:2210408I21Rik	UTSW	13	77323616	missense	possibly damaging	0.53
R9478:2210408I21Rik	UTSW	13	77303454	missense	possibly damaging	0.53
R9523:2210408I21Rik	UTSW	13	77259869	missense	possibly damaging	0.53
R9595:2210408I21Rik	UTSW	13	77316447	missense	probably benign
X0066:2210408I21Rik	UTSW	13	77183640	missense	possibly damaging	0.72
Z1088:2210408I21Rik	UTSW	13	77174891	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGCTTGCCTAAATTACAAAGCAT -3'
(R):5'- CCAGGGGAGGCATGATTTTA -3'

Sequencing Primer
(F):5'- TGCTCACAGAAGGAAAGAC -3'
(R):5'- AGGCATGATTTTAGTCCAGGAC -3'

Posted On

2016-04-27