Incidental Mutation 'R4943:Cldn10'
ID383299
Institutional Source Beutler Lab
Gene Symbol Cldn10
Ensembl Gene ENSMUSG00000022132
Gene Nameclaudin 10
SynonymsCldn10a, Cldn10b, D14Ertd728e
MMRRC Submission 042540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4943 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location118787908-118875489 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118788313 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 53 (G53S)
Ref Sequence ENSEMBL: ENSMUSP00000041616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047761] [ENSMUST00000071546]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047761
AA Change: G53S

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041616
Gene: ENSMUSG00000022132
AA Change: G53S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 177 9.2e-44 PFAM
Pfam:Claudin_2 13 179 3.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071546
AA Change: G53S

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000071476
Gene: ENSMUSG00000022132
AA Change: G53S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 3 167 9e-35 PFAM
Pfam:Claudin_2 13 160 2.4e-10 PFAM
Meta Mutation Damage Score 0.0852 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 99% (81/82)
MGI Phenotype FUNCTION: This intronless gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight unction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. Six alternatively spliced transcript variants have been identified, which encode different isoforms with distinct electric charge of the first extracellular loop and with or without the fourth transmembrane region. These isoforms exhibit distinct localization and function in paracellular anion or cation permeability. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice lacking expression of this gene in the thick ascending limb of renal tubules display nephrocalcinosis, hypermagnesemia, and abnormalities in renal reabsorbtion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik C A 13: 77,245,327 T366K possibly damaging Het
2510039O18Rik T A 4: 147,945,098 H508Q probably damaging Het
Actl9 G A 17: 33,433,085 V40M possibly damaging Het
Aen T A 7: 78,902,361 V23E probably damaging Het
Agbl1 G A 7: 76,420,016 R432K probably benign Het
Akap13 T A 7: 75,749,240 F2689I probably benign Het
Arhgap45 A G 10: 80,026,503 S475G probably benign Het
Atg7 A C 6: 114,697,084 Q231P probably benign Het
Calr3 A T 8: 72,431,377 V226D probably benign Het
Cops4 A T 5: 100,547,426 M404L probably benign Het
Cpne4 A T 9: 105,019,773 H375L probably damaging Het
D16Ertd472e A T 16: 78,575,989 V20D probably damaging Het
Dcun1d5 T C 9: 7,186,844 F55L possibly damaging Het
Dhx8 T A 11: 101,737,700 L93* probably null Het
Dtx4 A G 19: 12,501,060 L53P probably damaging Het
Ern2 C T 7: 122,173,258 R659H possibly damaging Het
Etl4 G A 2: 20,807,281 A1392T probably benign Het
Fat2 T C 11: 55,279,033 R2967G probably benign Het
Fat4 A G 3: 38,980,173 D2658G probably benign Het
Ftsj3 A G 11: 106,249,518 V808A probably damaging Het
Gm10447 A T 11: 53,456,389 Y104* probably null Het
Gm27013 A T 6: 130,676,200 C766* probably null Het
Gm438 T A 4: 144,777,720 E287V probably benign Het
Gm5581 A G 6: 131,167,125 noncoding transcript Het
Gpr158 G A 2: 21,827,157 V1023I probably damaging Het
Hectd2 T G 19: 36,604,247 probably null Het
Hmcn2 T C 2: 31,335,492 Y138H probably damaging Het
Kif28 T C 1: 179,713,951 I369V probably benign Het
Kif4-ps C T 12: 101,149,217 noncoding transcript Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Map3k20 G A 2: 72,371,918 M164I possibly damaging Het
Map4k4 A G 1: 40,019,594 I1050V probably damaging Het
Med23 T A 10: 24,875,669 V133D possibly damaging Het
Mycn A T 12: 12,937,079 L439Q probably damaging Het
Myh2 G T 11: 67,197,317 A1920S probably damaging Het
Myom3 T C 4: 135,814,274 V1392A possibly damaging Het
Nktr T A 9: 121,719,954 probably benign Het
Nme3 A G 17: 24,896,723 K48E probably damaging Het
Nt5dc1 T C 10: 34,310,391 R58G probably damaging Het
Nup205 A G 6: 35,224,639 E1270G probably damaging Het
Olfr106-ps G T 17: 37,395,025 A162S probably benign Het
Olfr1509 C G 14: 52,450,594 Y60* probably null Het
Olfr630 A T 7: 103,755,296 F96L probably benign Het
Olfr898 C T 9: 38,349,628 H176Y probably damaging Het
Pclo T C 5: 14,712,637 L3708P unknown Het
Pde4dip A T 3: 97,755,511 N590K probably damaging Het
Prokr1 A C 6: 87,581,824 I193S possibly damaging Het
Pxdc1 C A 13: 34,639,006 probably null Het
Rapgef2 A T 3: 79,064,547 S1494T probably benign Het
Rbms3 G C 9: 116,678,505 probably benign Het
Reep3 T A 10: 67,096,263 probably benign Het
Rwdd2b T C 16: 87,434,534 K244R possibly damaging Het
Srrm2 T C 17: 23,822,415 V2533A possibly damaging Het
Stab2 T C 10: 86,954,162 Y580C probably damaging Het
Stac2 G T 11: 98,041,572 S198R probably benign Het
Tdp2 T A 13: 24,838,265 N222K probably benign Het
Tex21 A G 12: 76,221,700 S103P probably damaging Het
Thbs1 A T 2: 118,113,449 I183F probably damaging Het
Tm9sf1 T C 14: 55,641,168 I256V probably damaging Het
Tmem207 C T 16: 26,517,853 W50* probably null Het
Trpm2 C A 10: 77,966,007 V75L probably damaging Het
Vmn1r227 A T 17: 20,735,361 noncoding transcript Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vmn2r75 A T 7: 86,165,497 S263T probably damaging Het
Wdr64 G A 1: 175,720,316 V140I probably benign Het
Xpo4 T C 14: 57,638,240 I145M possibly damaging Het
Zan G A 5: 137,457,890 T1336I unknown Het
Zdbf2 G T 1: 63,302,914 V151F possibly damaging Het
Zfhx3 T C 8: 108,948,317 S2000P probably damaging Het
Zfp65 T A 13: 67,710,980 I12F probably damaging Het
Zfp703 C A 8: 26,979,591 Q428K probably benign Het
Zfp947 A C 17: 22,145,832 M287R probably benign Het
Zfp976 A T 7: 42,612,422 probably benign Het
Other mutations in Cldn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Cldn10 APN 14 118873717 splice site probably benign
IGL02064:Cldn10 APN 14 118855012 missense probably damaging 1.00
R0090:Cldn10 UTSW 14 118874200 missense probably damaging 1.00
R1573:Cldn10 UTSW 14 118873668 missense probably benign 0.12
R3712:Cldn10 UTSW 14 118855110 missense probably damaging 1.00
R4897:Cldn10 UTSW 14 118788313 missense possibly damaging 0.88
R4941:Cldn10 UTSW 14 118788313 missense possibly damaging 0.88
R4942:Cldn10 UTSW 14 118788313 missense possibly damaging 0.88
R4998:Cldn10 UTSW 14 118788313 missense possibly damaging 0.88
R6160:Cldn10 UTSW 14 118861843 missense possibly damaging 0.61
R7205:Cldn10 UTSW 14 118861843 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TCCAGTGTCTGCATGCCTAG -3'
(R):5'- AATGTGGCGCTTTAGCACAC -3'

Sequencing Primer
(F):5'- ACCAAAGCCTTCTGTGTGGAC -3'
(R):5'- CTCGGAGTGAGTAGCCAACTG -3'
Posted On2016-04-27