Incidental Mutation 'R4944:Sema4c'
ID 383314
Institutional Source Beutler Lab
Gene Symbol Sema4c
Ensembl Gene ENSMUSG00000026121
Gene Name sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms M-Sema F, Semacl1, Semaf, Semai, Semacl1
MMRRC Submission 042541-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4944 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 36587720-36597430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36589392 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 578 (C578F)
Ref Sequence ENSEMBL: ENSMUSP00000141527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001172] [ENSMUST00000114991] [ENSMUST00000191642] [ENSMUST00000191677] [ENSMUST00000193382] [ENSMUST00000194894] [ENSMUST00000195620] [ENSMUST00000207843]
AlphaFold Q64151
Predicted Effect probably benign
Transcript: ENSMUST00000001172
SMART Domains Protein: ENSMUSP00000001172
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 8.77e2 SMART
ANK 63 92 1.08e-5 SMART
ANK 96 127 1.27e-2 SMART
ANK 129 158 5.62e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114991
AA Change: C578F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110643
Gene: ENSMUSG00000026121
AA Change: C578F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191642
AA Change: C578F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142284
Gene: ENSMUSG00000026121
AA Change: C578F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191677
AA Change: C578F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141263
Gene: ENSMUSG00000026121
AA Change: C578F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191785
Predicted Effect probably benign
Transcript: ENSMUST00000193382
Predicted Effect probably benign
Transcript: ENSMUST00000194894
SMART Domains Protein: ENSMUSP00000141712
Gene: ENSMUSG00000079610

DomainStartEndE-ValueType
ANK 30 59 5.6e0 SMART
ANK 63 92 7.1e-8 SMART
ANK 96 127 8.2e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195160
Predicted Effect probably damaging
Transcript: ENSMUST00000195620
AA Change: C578F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141527
Gene: ENSMUSG00000026121
AA Change: C578F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Sema 53 481 2.54e-183 SMART
PSI 499 552 4.52e-11 SMART
IG 563 647 1.77e-4 SMART
transmembrane domain 665 687 N/A INTRINSIC
low complexity region 754 774 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208269
Predicted Effect probably benign
Transcript: ENSMUST00000207843
Meta Mutation Damage Score 0.9401 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes a member of the semaphorin family of proteins that have diverse functions in neuronal development, heart morphogenesis, vascular growth, tumor progression and immune cell regulation. Lack of the encoded protein in some mice causes exencephaly resulting in neonatal lethality. Mice that bypass exencephaly show no obvious behavioral defects but display distinct pigmentation defects. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit exencephaly, neonatal lethality, and abnormal cerebellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,984,327 (GRCm39) probably null Het
Angptl7 C G 4: 148,584,534 (GRCm39) Q71H probably damaging Het
Arhgap30 A T 1: 171,229,822 (GRCm39) N176Y probably damaging Het
Armc9 T A 1: 86,202,256 (GRCm39) S805T probably damaging Het
Atxn1 T G 13: 45,720,407 (GRCm39) H496P probably damaging Het
Cabin1 C T 10: 75,557,197 (GRCm39) G1147D probably damaging Het
Cabin1 A G 10: 75,575,255 (GRCm39) S597P probably damaging Het
Catsperd T C 17: 56,969,744 (GRCm39) S613P probably damaging Het
Cdh2 A G 18: 16,783,466 (GRCm39) Y88H probably damaging Het
Cntn1 C A 15: 92,126,549 (GRCm39) P47Q probably damaging Het
Col11a2 T C 17: 34,261,164 (GRCm39) L38P possibly damaging Het
Col5a2 T G 1: 45,415,855 (GRCm39) I1431L possibly damaging Het
Csmd1 C T 8: 16,048,772 (GRCm39) G2310D probably damaging Het
Dhcr7 T A 7: 143,391,528 (GRCm39) I39N probably damaging Het
Dnajc13 C T 9: 104,044,586 (GRCm39) probably benign Het
Drgx G T 14: 32,330,206 (GRCm39) Q136H probably damaging Het
Folr2 T C 7: 101,489,497 (GRCm39) probably null Het
Galnt11 T C 5: 25,470,336 (GRCm39) I595T probably damaging Het
Gp5 G A 16: 30,128,326 (GRCm39) A116V possibly damaging Het
Gpn3 T C 5: 122,520,303 (GRCm39) probably benign Het
Gprin3 T C 6: 59,331,644 (GRCm39) N221S probably benign Het
Hfm1 T C 5: 107,022,079 (GRCm39) E989G possibly damaging Het
Ints1 T C 5: 139,743,847 (GRCm39) probably null Het
Josd2 T C 7: 44,120,592 (GRCm39) S110P probably damaging Het
Kat14 C A 2: 144,217,873 (GRCm39) T123K probably damaging Het
Lamtor1 C T 7: 101,558,971 (GRCm39) T48I probably damaging Het
Lrrc24 A G 15: 76,602,546 (GRCm39) L113P probably damaging Het
Lrrc37 T C 11: 103,504,286 (GRCm39) T2561A possibly damaging Het
Mog T C 17: 37,331,433 (GRCm39) E89G probably damaging Het
Mon2 A G 10: 122,874,364 (GRCm39) probably null Het
Mtx1 T C 3: 89,121,205 (GRCm39) Y143C probably benign Het
Nacad T C 11: 6,548,507 (GRCm39) E1409G possibly damaging Het
Ndst3 T C 3: 123,400,676 (GRCm39) H410R probably damaging Het
Nkx6-2 T C 7: 139,161,486 (GRCm39) E233G possibly damaging Het
Oas1h A G 5: 121,000,846 (GRCm39) E152G probably damaging Het
Or8g22 A G 9: 38,958,158 (GRCm39) S186P probably damaging Het
Ovgp1 T C 3: 105,887,269 (GRCm39) F222L possibly damaging Het
Pkhd1 T C 1: 20,358,429 (GRCm39) S2716G probably null Het
Pla2g4e T C 2: 120,001,718 (GRCm39) T644A probably benign Het
Plxnd1 A G 6: 115,932,726 (GRCm39) I1918T probably damaging Het
Psmg1 A T 16: 95,790,812 (GRCm39) probably benign Het
Ptprd G A 4: 76,047,136 (GRCm39) R364C probably damaging Het
Rgs22 T C 15: 36,026,088 (GRCm39) I945V possibly damaging Het
Rgs7bp T C 13: 105,088,072 (GRCm39) N234S probably benign Het
Rrp7a T C 15: 83,004,010 (GRCm39) probably benign Het
Scg2 T A 1: 79,414,193 (GRCm39) R177* probably null Het
Slc1a5 T A 7: 16,531,668 (GRCm39) probably benign Het
Slc5a3 A G 16: 91,875,571 (GRCm39) T543A possibly damaging Het
Slx4ip T A 2: 136,888,687 (GRCm39) F123I probably benign Het
Smtn C T 11: 3,472,916 (GRCm39) R737H probably damaging Het
Stox2 A G 8: 47,866,300 (GRCm39) I14T possibly damaging Het
Stradb T C 1: 59,019,599 (GRCm39) F43L probably benign Het
Szt2 T C 4: 118,245,866 (GRCm39) D1029G probably benign Het
Taar6 T C 10: 23,860,613 (GRCm39) Y311C probably damaging Het
Tcea3 A T 4: 135,995,404 (GRCm39) N249I probably damaging Het
Tecta A G 9: 42,241,573 (GRCm39) M2134T probably benign Het
Tg G A 15: 66,636,186 (GRCm39) G591D probably damaging Het
Tm4sf20 T A 1: 82,746,084 (GRCm39) I19F probably benign Het
Top2a T C 11: 98,888,676 (GRCm39) K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 (GRCm39) probably benign Het
Usp29 T C 7: 6,964,927 (GRCm39) S257P possibly damaging Het
Usp40 T C 1: 87,880,077 (GRCm39) N1038S probably benign Het
Utp25 A T 1: 192,797,262 (GRCm39) M530K probably damaging Het
Vmn1r121 C T 7: 20,831,538 (GRCm39) E301K probably benign Het
Vmn2r49 T A 7: 9,722,959 (GRCm39) H105L probably benign Het
Zgrf1 C T 3: 127,355,517 (GRCm39) Q248* probably null Het
Other mutations in Sema4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Sema4c APN 1 36,593,001 (GRCm39) critical splice donor site probably benign 0.00
IGL01824:Sema4c APN 1 36,592,110 (GRCm39) missense possibly damaging 0.76
IGL02236:Sema4c APN 1 36,592,166 (GRCm39) missense probably damaging 1.00
IGL02262:Sema4c APN 1 36,589,422 (GRCm39) missense probably damaging 1.00
IGL02282:Sema4c APN 1 36,589,284 (GRCm39) splice site probably null
IGL02476:Sema4c APN 1 36,595,031 (GRCm39) missense probably damaging 0.98
IGL02900:Sema4c APN 1 36,589,826 (GRCm39) nonsense probably null
swirl UTSW 1 36,589,392 (GRCm39) missense probably damaging 1.00
IGL02837:Sema4c UTSW 1 36,591,965 (GRCm39) missense probably damaging 1.00
R0427:Sema4c UTSW 1 36,592,892 (GRCm39) nonsense probably null
R0497:Sema4c UTSW 1 36,588,689 (GRCm39) missense probably benign 0.04
R1066:Sema4c UTSW 1 36,589,281 (GRCm39) missense possibly damaging 0.95
R1099:Sema4c UTSW 1 36,591,191 (GRCm39) missense probably damaging 1.00
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1146:Sema4c UTSW 1 36,589,646 (GRCm39) missense probably benign 0.04
R1639:Sema4c UTSW 1 36,592,615 (GRCm39) missense probably benign 0.00
R1644:Sema4c UTSW 1 36,589,885 (GRCm39) missense probably damaging 1.00
R3176:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3177:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3276:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3277:Sema4c UTSW 1 36,588,960 (GRCm39) missense possibly damaging 0.65
R3551:Sema4c UTSW 1 36,592,804 (GRCm39) missense probably benign 0.02
R4452:Sema4c UTSW 1 36,592,837 (GRCm39) missense probably benign 0.31
R4883:Sema4c UTSW 1 36,591,097 (GRCm39) missense probably damaging 0.98
R4895:Sema4c UTSW 1 36,592,651 (GRCm39) splice site probably null
R4913:Sema4c UTSW 1 36,589,266 (GRCm39) missense probably benign 0.11
R5062:Sema4c UTSW 1 36,592,059 (GRCm39) critical splice donor site probably null
R5077:Sema4c UTSW 1 36,590,812 (GRCm39) missense probably benign 0.20
R5109:Sema4c UTSW 1 36,591,381 (GRCm39) frame shift probably null
R5208:Sema4c UTSW 1 36,589,407 (GRCm39) missense probably damaging 1.00
R5551:Sema4c UTSW 1 36,591,398 (GRCm39) missense probably damaging 1.00
R5912:Sema4c UTSW 1 36,593,469 (GRCm39) missense possibly damaging 0.83
R6578:Sema4c UTSW 1 36,589,834 (GRCm39) missense probably benign 0.02
R7111:Sema4c UTSW 1 36,592,160 (GRCm39) missense possibly damaging 0.48
R7141:Sema4c UTSW 1 36,592,101 (GRCm39) missense probably damaging 0.99
R7252:Sema4c UTSW 1 36,589,096 (GRCm39) missense probably damaging 1.00
R7495:Sema4c UTSW 1 36,589,774 (GRCm39) missense probably benign 0.00
R7891:Sema4c UTSW 1 36,588,995 (GRCm39) missense probably damaging 0.98
R7895:Sema4c UTSW 1 36,592,199 (GRCm39) missense probably damaging 1.00
R8264:Sema4c UTSW 1 36,591,966 (GRCm39) missense probably damaging 1.00
R8478:Sema4c UTSW 1 36,590,871 (GRCm39) missense probably benign 0.04
R8680:Sema4c UTSW 1 36,589,867 (GRCm39) missense probably benign 0.00
R8733:Sema4c UTSW 1 36,591,954 (GRCm39) missense probably damaging 1.00
R9017:Sema4c UTSW 1 36,592,079 (GRCm39) missense probably damaging 1.00
R9344:Sema4c UTSW 1 36,592,395 (GRCm39) missense probably damaging 1.00
R9488:Sema4c UTSW 1 36,591,067 (GRCm39) missense probably benign
X0019:Sema4c UTSW 1 36,592,077 (GRCm39) missense probably damaging 1.00
X0028:Sema4c UTSW 1 36,589,047 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCTGCTCCTCTGAATAGCAAC -3'
(R):5'- ATGTGGCGAACTTGGACAC -3'

Sequencing Primer
(F):5'- TCCTCTGAATAGCAACGATAGGGTC -3'
(R):5'- CGAACTTGGACACTTCAAAGATGTG -3'
Posted On 2016-04-27