Incidental Mutation 'R4944:Stradb'
ID383316
Institutional Source Beutler Lab
Gene Symbol Stradb
Ensembl Gene ENSMUSG00000026027
Gene NameSTE20-related kinase adaptor beta
SynonymsAls2cr2, D1Ucla2, PRO1038
MMRRC Submission 042541-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4944 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58973522-58995715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58980440 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 43 (F43L)
Ref Sequence ENSEMBL: ENSMUSP00000137724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027185] [ENSMUST00000114296] [ENSMUST00000123301] [ENSMUST00000153990]
Predicted Effect probably benign
Transcript: ENSMUST00000027185
SMART Domains Protein: ENSMUSP00000027185
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 58 290 3.2e-26 PFAM
Pfam:Pkinase 58 369 7.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114296
SMART Domains Protein: ENSMUSP00000109935
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 185 1.1e-16 PFAM
Pfam:Pkinase_Tyr 58 188 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123301
SMART Domains Protein: ENSMUSP00000138036
Gene: ENSMUSG00000026027

DomainStartEndE-ValueType
Pfam:Pkinase 58 184 2.7e-17 PFAM
Pfam:Pkinase_Tyr 58 185 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147637
Predicted Effect probably benign
Transcript: ENSMUST00000153990
AA Change: F43L

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,934,327 probably null Het
Angptl7 C G 4: 148,500,077 Q71H probably damaging Het
Arhgap30 A T 1: 171,402,254 N176Y probably damaging Het
Armc9 T A 1: 86,274,534 S805T probably damaging Het
Atxn1 T G 13: 45,566,931 H496P probably damaging Het
Cabin1 C T 10: 75,721,363 G1147D probably damaging Het
Cabin1 A G 10: 75,739,421 S597P probably damaging Het
Catsperd T C 17: 56,662,744 S613P probably damaging Het
Cdh2 A G 18: 16,650,409 Y88H probably damaging Het
Cntn1 C A 15: 92,228,668 P47Q probably damaging Het
Col11a2 T C 17: 34,042,190 L38P possibly damaging Het
Col5a2 T G 1: 45,376,695 I1431L possibly damaging Het
Csmd1 C T 8: 15,998,772 G2310D probably damaging Het
Dhcr7 T A 7: 143,837,791 I39N probably damaging Het
Diexf A T 1: 193,114,954 M530K probably damaging Het
Dnajc13 C T 9: 104,167,387 probably benign Het
Folr2 T C 7: 101,840,290 probably null Het
Galnt11 T C 5: 25,265,338 I595T probably damaging Het
Gm884 T C 11: 103,613,460 T2561A possibly damaging Het
Gp5 G A 16: 30,309,508 A116V possibly damaging Het
Gpn3 T C 5: 122,382,240 probably benign Het
Gprin3 T C 6: 59,354,659 N221S probably benign Het
Hfm1 T C 5: 106,874,213 E989G possibly damaging Het
Ints1 T C 5: 139,758,092 probably null Het
Josd2 T C 7: 44,471,168 S110P probably damaging Het
Kat14 C A 2: 144,375,953 T123K probably damaging Het
Lamtor1 C T 7: 101,909,764 T48I probably damaging Het
Lrrc24 A G 15: 76,718,346 L113P probably damaging Het
Mog T C 17: 37,020,541 E89G probably damaging Het
Mon2 A G 10: 123,038,459 probably null Het
Mtx1 T C 3: 89,213,898 Y143C probably benign Het
Nacad T C 11: 6,598,507 E1409G possibly damaging Het
Ndst3 T C 3: 123,607,027 H410R probably damaging Het
Nkx6-2 T C 7: 139,581,570 E233G possibly damaging Het
Oas1h A G 5: 120,862,783 E152G probably damaging Het
Olfr936 A G 9: 39,046,862 S186P probably damaging Het
Ovgp1 T C 3: 105,979,953 F222L possibly damaging Het
Pkhd1 T C 1: 20,288,205 S2716G probably null Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Plxnd1 A G 6: 115,955,765 I1918T probably damaging Het
Prrxl1 G T 14: 32,608,249 Q136H probably damaging Het
Psmg1 A T 16: 95,989,612 probably benign Het
Ptprd G A 4: 76,128,899 R364C probably damaging Het
Rgs22 T C 15: 36,025,942 I945V possibly damaging Het
Rgs7bp T C 13: 104,951,564 N234S probably benign Het
Rrp7a T C 15: 83,119,809 probably benign Het
Scg2 T A 1: 79,436,476 R177* probably null Het
Sema4c C A 1: 36,550,311 C578F probably damaging Het
Slc1a5 T A 7: 16,797,743 probably benign Het
Slc5a3 A G 16: 92,078,683 T543A possibly damaging Het
Slx4ip T A 2: 137,046,767 F123I probably benign Het
Smtn C T 11: 3,522,916 R737H probably damaging Het
Stox2 A G 8: 47,413,265 I14T possibly damaging Het
Szt2 T C 4: 118,388,669 D1029G probably benign Het
Taar6 T C 10: 23,984,715 Y311C probably damaging Het
Tcea3 A T 4: 136,268,093 N249I probably damaging Het
Tecta A G 9: 42,330,277 M2134T probably benign Het
Tg G A 15: 66,764,337 G591D probably damaging Het
Tm4sf20 T A 1: 82,768,363 I19F probably benign Het
Top2a T C 11: 98,997,850 K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 probably benign Het
Usp29 T C 7: 6,961,928 S257P possibly damaging Het
Usp40 T C 1: 87,952,355 N1038S probably benign Het
Vmn1r121 C T 7: 21,097,613 E301K probably benign Het
Vmn2r49 T A 7: 9,989,032 H105L probably benign Het
Zgrf1 C T 3: 127,561,868 Q248* probably null Het
Other mutations in Stradb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Stradb APN 1 58988529 missense probably damaging 0.98
IGL00843:Stradb APN 1 58994409 missense probably benign
IGL01288:Stradb APN 1 58992301 missense possibly damaging 0.61
IGL02045:Stradb APN 1 58989778 missense probably damaging 1.00
IGL02818:Stradb APN 1 58979962 missense probably damaging 0.99
P0047:Stradb UTSW 1 58989798 missense probably null 0.86
R0739:Stradb UTSW 1 58977015 unclassified probably benign
R0970:Stradb UTSW 1 58977060 missense possibly damaging 0.92
R1809:Stradb UTSW 1 58994390 missense possibly damaging 0.54
R1930:Stradb UTSW 1 58991105 missense probably benign 0.07
R1931:Stradb UTSW 1 58991105 missense probably benign 0.07
R1932:Stradb UTSW 1 58991105 missense probably benign 0.07
R2570:Stradb UTSW 1 58988584 missense probably damaging 1.00
R2919:Stradb UTSW 1 58992669 missense probably benign 0.44
R3104:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3105:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3106:Stradb UTSW 1 58992291 missense possibly damaging 0.86
R3772:Stradb UTSW 1 58985385 missense probably benign 0.04
R4120:Stradb UTSW 1 58980009 missense possibly damaging 0.92
R4417:Stradb UTSW 1 58994372 missense probably benign
R4569:Stradb UTSW 1 58979958 nonsense probably null
R4601:Stradb UTSW 1 58993572 missense probably damaging 0.98
R4758:Stradb UTSW 1 58988571 missense probably benign 0.02
R4786:Stradb UTSW 1 58991208 intron probably benign
R5113:Stradb UTSW 1 58991174 intron probably benign
R5568:Stradb UTSW 1 58992742 missense possibly damaging 0.72
R5765:Stradb UTSW 1 58992744 missense probably benign 0.31
R5970:Stradb UTSW 1 58980016 critical splice donor site probably null
R6234:Stradb UTSW 1 58988548 missense probably damaging 1.00
R7411:Stradb UTSW 1 58988518 missense possibly damaging 0.95
R7511:Stradb UTSW 1 58992949 missense probably damaging 0.97
R7569:Stradb UTSW 1 58991151 missense unknown
R7575:Stradb UTSW 1 58988580 missense probably benign 0.00
R7646:Stradb UTSW 1 58994408 missense probably benign 0.14
R7658:Stradb UTSW 1 58992726 missense probably damaging 0.96
R8306:Stradb UTSW 1 58991197 missense unknown
R8812:Stradb UTSW 1 58994319 missense probably benign 0.16
Z1176:Stradb UTSW 1 58992999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCAGATTTACGCTTCCCAGG -3'
(R):5'- CTGGTCATACACAATACCATTGAG -3'

Sequencing Primer
(F):5'- AGGGTCCTGGGGTATCTATAGAATAC -3'
(R):5'- TGAGAGTCTCAATCATGCTCAGAG -3'
Posted On2016-04-27