Incidental Mutation 'R4944:Kat14'
ID 383325
Institutional Source Beutler Lab
Gene Symbol Kat14
Ensembl Gene ENSMUSG00000027425
Gene Name lysine acetyltransferase 14
Synonyms D2Wsu131e, 2510008M08Rik, ATAC2, Csrp2bp, D2Ertd473e
MMRRC Submission 042541-MU
Accession Numbers

Genbank: NM_181417; MGI: 1917264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4944 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 144368983-144407676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 144375953 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 123 (T123K)
Ref Sequence ENSEMBL: ENSMUSP00000028911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028911] [ENSMUST00000147747] [ENSMUST00000183618]
AlphaFold Q8CID0
Predicted Effect probably damaging
Transcript: ENSMUST00000028911
AA Change: T123K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028911
Gene: ENSMUSG00000027425
AA Change: T123K

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 310 334 N/A INTRINSIC
Pfam:Acetyltransf_10 640 748 7e-12 PFAM
Pfam:Acetyltransf_7 670 750 5.8e-12 PFAM
Pfam:Acetyltransf_1 675 749 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131836
Predicted Effect probably benign
Transcript: ENSMUST00000147747
SMART Domains Protein: ENSMUSP00000130785
Gene: ENSMUSG00000027425

DomainStartEndE-ValueType
low complexity region 99 123 N/A INTRINSIC
Pfam:Acetyltransf_10 428 537 6.3e-12 PFAM
Pfam:Acetyltransf_7 458 539 5.7e-12 PFAM
Pfam:Acetyltransf_1 464 538 3.1e-12 PFAM
Pfam:FR47 479 544 2.4e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156410
AA Change: T54K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171261
Predicted Effect probably benign
Transcript: ENSMUST00000183618
SMART Domains Protein: ENSMUSP00000139043
Gene: ENSMUSG00000098387

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 27 36 N/A INTRINSIC
Meta Mutation Damage Score 0.3473 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, decreased size, increased apoptosis, and disrupted cell cycling. Mice heterozygous for one targeted allele exhibit corneal opacity. [provided by MGI curators]
Allele List at MGI

All alleles(54) : Targeted, other(1) Gene trapped(53)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,934,327 probably null Het
Angptl7 C G 4: 148,500,077 Q71H probably damaging Het
Arhgap30 A T 1: 171,402,254 N176Y probably damaging Het
Armc9 T A 1: 86,274,534 S805T probably damaging Het
Atxn1 T G 13: 45,566,931 H496P probably damaging Het
Cabin1 C T 10: 75,721,363 G1147D probably damaging Het
Cabin1 A G 10: 75,739,421 S597P probably damaging Het
Catsperd T C 17: 56,662,744 S613P probably damaging Het
Cdh2 A G 18: 16,650,409 Y88H probably damaging Het
Cntn1 C A 15: 92,228,668 P47Q probably damaging Het
Col11a2 T C 17: 34,042,190 L38P possibly damaging Het
Col5a2 T G 1: 45,376,695 I1431L possibly damaging Het
Csmd1 C T 8: 15,998,772 G2310D probably damaging Het
Dhcr7 T A 7: 143,837,791 I39N probably damaging Het
Diexf A T 1: 193,114,954 M530K probably damaging Het
Dnajc13 C T 9: 104,167,387 probably benign Het
Folr2 T C 7: 101,840,290 probably null Het
Galnt11 T C 5: 25,265,338 I595T probably damaging Het
Gm884 T C 11: 103,613,460 T2561A possibly damaging Het
Gp5 G A 16: 30,309,508 A116V possibly damaging Het
Gpn3 T C 5: 122,382,240 probably benign Het
Gprin3 T C 6: 59,354,659 N221S probably benign Het
Hfm1 T C 5: 106,874,213 E989G possibly damaging Het
Ints1 T C 5: 139,758,092 probably null Het
Josd2 T C 7: 44,471,168 S110P probably damaging Het
Lamtor1 C T 7: 101,909,764 T48I probably damaging Het
Lrrc24 A G 15: 76,718,346 L113P probably damaging Het
Mog T C 17: 37,020,541 E89G probably damaging Het
Mon2 A G 10: 123,038,459 probably null Het
Mtx1 T C 3: 89,213,898 Y143C probably benign Het
Nacad T C 11: 6,598,507 E1409G possibly damaging Het
Ndst3 T C 3: 123,607,027 H410R probably damaging Het
Nkx6-2 T C 7: 139,581,570 E233G possibly damaging Het
Oas1h A G 5: 120,862,783 E152G probably damaging Het
Olfr936 A G 9: 39,046,862 S186P probably damaging Het
Ovgp1 T C 3: 105,979,953 F222L possibly damaging Het
Pkhd1 T C 1: 20,288,205 S2716G probably null Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Plxnd1 A G 6: 115,955,765 I1918T probably damaging Het
Prrxl1 G T 14: 32,608,249 Q136H probably damaging Het
Psmg1 A T 16: 95,989,612 probably benign Het
Ptprd G A 4: 76,128,899 R364C probably damaging Het
Rgs22 T C 15: 36,025,942 I945V possibly damaging Het
Rgs7bp T C 13: 104,951,564 N234S probably benign Het
Rrp7a T C 15: 83,119,809 probably benign Het
Scg2 T A 1: 79,436,476 R177* probably null Het
Sema4c C A 1: 36,550,311 C578F probably damaging Het
Slc1a5 T A 7: 16,797,743 probably benign Het
Slc5a3 A G 16: 92,078,683 T543A possibly damaging Het
Slx4ip T A 2: 137,046,767 F123I probably benign Het
Smtn C T 11: 3,522,916 R737H probably damaging Het
Stox2 A G 8: 47,413,265 I14T possibly damaging Het
Stradb T C 1: 58,980,440 F43L probably benign Het
Szt2 T C 4: 118,388,669 D1029G probably benign Het
Taar6 T C 10: 23,984,715 Y311C probably damaging Het
Tcea3 A T 4: 136,268,093 N249I probably damaging Het
Tecta A G 9: 42,330,277 M2134T probably benign Het
Tg G A 15: 66,764,337 G591D probably damaging Het
Tm4sf20 T A 1: 82,768,363 I19F probably benign Het
Top2a T C 11: 98,997,850 K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 probably benign Het
Usp29 T C 7: 6,961,928 S257P possibly damaging Het
Usp40 T C 1: 87,952,355 N1038S probably benign Het
Vmn1r121 C T 7: 21,097,613 E301K probably benign Het
Vmn2r49 T A 7: 9,989,032 H105L probably benign Het
Zgrf1 C T 3: 127,561,868 Q248* probably null Het
Other mutations in Kat14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Kat14 APN 2 144394255 missense probably benign 0.01
IGL01361:Kat14 APN 2 144406620 splice site probably null
IGL01958:Kat14 APN 2 144394365 missense probably damaging 1.00
IGL02499:Kat14 APN 2 144393831 missense probably benign 0.45
IGL02625:Kat14 APN 2 144402445 missense possibly damaging 0.79
IGL02814:Kat14 APN 2 144402463 missense probably benign
IGL02883:Kat14 APN 2 144393529 missense probably damaging 1.00
IGL03114:Kat14 APN 2 144375965 critical splice donor site probably null
A5278:Kat14 UTSW 2 144393307 nonsense probably null
R1446:Kat14 UTSW 2 144373718 missense probably damaging 1.00
R1517:Kat14 UTSW 2 144373791 missense probably benign 0.00
R1589:Kat14 UTSW 2 144394100 missense probably benign 0.06
R2071:Kat14 UTSW 2 144389216 missense probably damaging 1.00
R3911:Kat14 UTSW 2 144404062 missense probably damaging 1.00
R3951:Kat14 UTSW 2 144407329 utr 3 prime probably benign
R4167:Kat14 UTSW 2 144394110 missense probably damaging 1.00
R4624:Kat14 UTSW 2 144404220 intron probably benign
R4628:Kat14 UTSW 2 144404220 intron probably benign
R4629:Kat14 UTSW 2 144404220 intron probably benign
R5401:Kat14 UTSW 2 144389260 missense possibly damaging 0.77
R5429:Kat14 UTSW 2 144393323 missense probably benign 0.03
R7165:Kat14 UTSW 2 144393998 missense probably benign 0.03
R7453:Kat14 UTSW 2 144380734 missense possibly damaging 0.85
R7738:Kat14 UTSW 2 144394242 missense probably damaging 1.00
R9130:Kat14 UTSW 2 144373822 missense probably benign 0.30
R9260:Kat14 UTSW 2 144393521 missense probably benign 0.02
X0018:Kat14 UTSW 2 144373857 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGGTCTAGTTGGTTAACAGAGC -3'
(R):5'- CGCTGTGGGTCTAAGTTCAG -3'

Sequencing Primer
(F):5'- ACAGAGCTGTTGGAGTGCCAC -3'
(R):5'- TCTCAAGAATTCACTAAATTAGCAGC -3'
Posted On 2016-04-27