Incidental Mutation 'R4944:Ovgp1'
ID383327
Institutional Source Beutler Lab
Gene Symbol Ovgp1
Ensembl Gene ENSMUSG00000074340
Gene Nameoviductal glycoprotein 1
SynonymsChit5, MOGP, muc9, mucin 9, OGP, oviductin
MMRRC Submission 042541-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4944 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location105973711-105987423 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105979953 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 222 (F222L)
Ref Sequence ENSEMBL: ENSMUSP00000000573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000573] [ENSMUST00000163626]
Predicted Effect possibly damaging
Transcript: ENSMUST00000000573
AA Change: F222L

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000000573
Gene: ENSMUSG00000074340
AA Change: F222L

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
Glyco_18 22 360 1.38e-134 SMART
low complexity region 486 515 N/A INTRINSIC
low complexity region 533 626 N/A INTRINSIC
low complexity region 637 648 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000092878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137168
Predicted Effect probably benign
Transcript: ENSMUST00000163626
SMART Domains Protein: ENSMUSP00000132424
Gene: ENSMUSG00000074340

DomainStartEndE-ValueType
Glyco_18 9 226 8.52e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167642
Meta Mutation Damage Score 0.4012 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, carbohydrate-rich, epithelial glycoprotein with numerous O-glycosylation sites located within threonine, serine, and proline-rich tandem repeats. The gene is similar to members of the mucin and the glycosyl hydrolase 18 gene families. Regulation of expression may be estrogen-dependent. Gene expression and protein secretion occur during late follicular development through early cleavage-stage embryonic development. The protein is secreted from non-ciliated oviductal epithelial cells and associates with ovulated oocytes, blastomeres, and spermatozoan acrosomal regions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene show no phenotypic abnormalities. Female reproduction is essentially normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,934,327 probably null Het
Angptl7 C G 4: 148,500,077 Q71H probably damaging Het
Arhgap30 A T 1: 171,402,254 N176Y probably damaging Het
Armc9 T A 1: 86,274,534 S805T probably damaging Het
Atxn1 T G 13: 45,566,931 H496P probably damaging Het
Cabin1 C T 10: 75,721,363 G1147D probably damaging Het
Cabin1 A G 10: 75,739,421 S597P probably damaging Het
Catsperd T C 17: 56,662,744 S613P probably damaging Het
Cdh2 A G 18: 16,650,409 Y88H probably damaging Het
Cntn1 C A 15: 92,228,668 P47Q probably damaging Het
Col11a2 T C 17: 34,042,190 L38P possibly damaging Het
Col5a2 T G 1: 45,376,695 I1431L possibly damaging Het
Csmd1 C T 8: 15,998,772 G2310D probably damaging Het
Dhcr7 T A 7: 143,837,791 I39N probably damaging Het
Diexf A T 1: 193,114,954 M530K probably damaging Het
Dnajc13 C T 9: 104,167,387 probably benign Het
Folr2 T C 7: 101,840,290 probably null Het
Galnt11 T C 5: 25,265,338 I595T probably damaging Het
Gm884 T C 11: 103,613,460 T2561A possibly damaging Het
Gp5 G A 16: 30,309,508 A116V possibly damaging Het
Gpn3 T C 5: 122,382,240 probably benign Het
Gprin3 T C 6: 59,354,659 N221S probably benign Het
Hfm1 T C 5: 106,874,213 E989G possibly damaging Het
Ints1 T C 5: 139,758,092 probably null Het
Josd2 T C 7: 44,471,168 S110P probably damaging Het
Kat14 C A 2: 144,375,953 T123K probably damaging Het
Lamtor1 C T 7: 101,909,764 T48I probably damaging Het
Lrrc24 A G 15: 76,718,346 L113P probably damaging Het
Mog T C 17: 37,020,541 E89G probably damaging Het
Mon2 A G 10: 123,038,459 probably null Het
Mtx1 T C 3: 89,213,898 Y143C probably benign Het
Nacad T C 11: 6,598,507 E1409G possibly damaging Het
Ndst3 T C 3: 123,607,027 H410R probably damaging Het
Nkx6-2 T C 7: 139,581,570 E233G possibly damaging Het
Oas1h A G 5: 120,862,783 E152G probably damaging Het
Olfr936 A G 9: 39,046,862 S186P probably damaging Het
Pkhd1 T C 1: 20,288,205 S2716G probably null Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Plxnd1 A G 6: 115,955,765 I1918T probably damaging Het
Prrxl1 G T 14: 32,608,249 Q136H probably damaging Het
Psmg1 A T 16: 95,989,612 probably benign Het
Ptprd G A 4: 76,128,899 R364C probably damaging Het
Rgs22 T C 15: 36,025,942 I945V possibly damaging Het
Rgs7bp T C 13: 104,951,564 N234S probably benign Het
Rrp7a T C 15: 83,119,809 probably benign Het
Scg2 T A 1: 79,436,476 R177* probably null Het
Sema4c C A 1: 36,550,311 C578F probably damaging Het
Slc1a5 T A 7: 16,797,743 probably benign Het
Slc5a3 A G 16: 92,078,683 T543A possibly damaging Het
Slx4ip T A 2: 137,046,767 F123I probably benign Het
Smtn C T 11: 3,522,916 R737H probably damaging Het
Stox2 A G 8: 47,413,265 I14T possibly damaging Het
Stradb T C 1: 58,980,440 F43L probably benign Het
Szt2 T C 4: 118,388,669 D1029G probably benign Het
Taar6 T C 10: 23,984,715 Y311C probably damaging Het
Tcea3 A T 4: 136,268,093 N249I probably damaging Het
Tecta A G 9: 42,330,277 M2134T probably benign Het
Tg G A 15: 66,764,337 G591D probably damaging Het
Tm4sf20 T A 1: 82,768,363 I19F probably benign Het
Top2a T C 11: 98,997,850 K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 probably benign Het
Usp29 T C 7: 6,961,928 S257P possibly damaging Het
Usp40 T C 1: 87,952,355 N1038S probably benign Het
Vmn1r121 C T 7: 21,097,613 E301K probably benign Het
Vmn2r49 T A 7: 9,989,032 H105L probably benign Het
Zgrf1 C T 3: 127,561,868 Q248* probably null Het
Other mutations in Ovgp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Ovgp1 APN 3 105981277 nonsense probably null
IGL01152:Ovgp1 APN 3 105986172 missense possibly damaging 0.94
IGL01458:Ovgp1 APN 3 105974991 missense probably benign 0.01
IGL01646:Ovgp1 APN 3 105978349 missense probably damaging 1.00
IGL01768:Ovgp1 APN 3 105981351 critical splice donor site probably null
IGL02712:Ovgp1 APN 3 105986513 unclassified probably benign
IGL03065:Ovgp1 APN 3 105986366 missense probably benign 0.01
IGL03140:Ovgp1 APN 3 105979906 missense probably damaging 1.00
IGL03272:Ovgp1 APN 3 105981325 missense probably damaging 0.99
PIT4472001:Ovgp1 UTSW 3 105986990 missense unknown
R0277:Ovgp1 UTSW 3 105979892 intron probably benign
R0560:Ovgp1 UTSW 3 105986410 unclassified probably benign
R0718:Ovgp1 UTSW 3 105974830 splice site probably benign
R0743:Ovgp1 UTSW 3 105974932 missense probably damaging 1.00
R1362:Ovgp1 UTSW 3 105986575 unclassified probably benign
R1556:Ovgp1 UTSW 3 105986752 unclassified probably benign
R1776:Ovgp1 UTSW 3 105977798 missense possibly damaging 0.52
R1831:Ovgp1 UTSW 3 105985068 missense probably benign 0.04
R1986:Ovgp1 UTSW 3 105974935 missense probably damaging 1.00
R2004:Ovgp1 UTSW 3 105986993 unclassified probably benign
R2156:Ovgp1 UTSW 3 105977717 missense possibly damaging 0.49
R2254:Ovgp1 UTSW 3 105986912 unclassified probably benign
R2860:Ovgp1 UTSW 3 105986567 unclassified probably benign
R2861:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3117:Ovgp1 UTSW 3 105986452 unclassified probably benign
R3793:Ovgp1 UTSW 3 105980171 missense probably benign 0.03
R3835:Ovgp1 UTSW 3 105986315 missense probably benign 0.00
R3894:Ovgp1 UTSW 3 105986567 unclassified probably benign
R3894:Ovgp1 UTSW 3 105986596 unclassified probably benign
R3895:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986596 unclassified probably benign
R4050:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4467:Ovgp1 UTSW 3 105977711 missense probably benign 0.04
R4611:Ovgp1 UTSW 3 105986567 unclassified probably benign
R4628:Ovgp1 UTSW 3 105980323 intron probably null
R4738:Ovgp1 UTSW 3 105979918 missense probably damaging 1.00
R5110:Ovgp1 UTSW 3 105977783 missense probably damaging 1.00
R6531:Ovgp1 UTSW 3 105987071 unclassified probably benign
R6540:Ovgp1 UTSW 3 105986581 nonsense probably null
R6562:Ovgp1 UTSW 3 105980273 missense probably damaging 1.00
R6601:Ovgp1 UTSW 3 105986431 unclassified probably benign
R6906:Ovgp1 UTSW 3 105986873 unclassified probably benign
R7313:Ovgp1 UTSW 3 105987071 missense unknown
R7430:Ovgp1 UTSW 3 105986303 missense possibly damaging 0.62
R7430:Ovgp1 UTSW 3 105986302 missense probably damaging 0.99
R7566:Ovgp1 UTSW 3 105974310 start gained probably benign
R7684:Ovgp1 UTSW 3 105979956 missense probably damaging 0.99
R7805:Ovgp1 UTSW 3 105986794 missense unknown
R7820:Ovgp1 UTSW 3 105986521 unclassified probably benign
R8039:Ovgp1 UTSW 3 105976023 missense probably benign 0.26
Z1177:Ovgp1 UTSW 3 105986840 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCCAGGGCAGGTTCATAAG -3'
(R):5'- TACGTCCATAGGTGGGGAAAC -3'

Sequencing Primer
(F):5'- CAGGTTCATAAGAGCAAGGAAC -3'
(R):5'- CCCATAATAAGTTTATCTGCGGGTG -3'
Posted On2016-04-27