Incidental Mutation 'R4944:Angptl7'
List |< first << previous [record 99 of 1826] next >> last >|
ID383334
Institutional Source Beutler Lab
Gene Symbol Angptl7
Ensembl Gene ENSMUSG00000028989
Gene Nameangiopoietin-like 7
Synonyms
MMRRC Submission 042541-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4944 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148495183-148500460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 148500077 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 71 (Q71H)
Ref Sequence ENSEMBL: ENSMUSP00000030840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030840] [ENSMUST00000103221]
Predicted Effect probably damaging
Transcript: ENSMUST00000030840
AA Change: Q71H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030840
Gene: ENSMUSG00000028989
AA Change: Q71H

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 36 110 N/A INTRINSIC
FBG 117 333 7.61e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103221
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype NO_PHENOTYPE,Mice homozygous for a null allele exhibit embryonic lethality by E12.5 due to abnormal embryogenesis. Mice homozygous for an ENU mutation exhibit embryonic lethality by E12.5 with abnormal embryogenesis and brain development. Mice homozygous for a gene trap allele exhibit abnormal embryogenesis.
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,934,327 probably null Het
Arhgap30 A T 1: 171,402,254 N176Y probably damaging Het
Armc9 T A 1: 86,274,534 S805T probably damaging Het
Atxn1 T G 13: 45,566,931 H496P probably damaging Het
Cabin1 C T 10: 75,721,363 G1147D probably damaging Het
Cabin1 A G 10: 75,739,421 S597P probably damaging Het
Catsperd T C 17: 56,662,744 S613P probably damaging Het
Cdh2 A G 18: 16,650,409 Y88H probably damaging Het
Cntn1 C A 15: 92,228,668 P47Q probably damaging Het
Col11a2 T C 17: 34,042,190 L38P possibly damaging Het
Col5a2 T G 1: 45,376,695 I1431L possibly damaging Het
Csmd1 C T 8: 15,998,772 G2310D probably damaging Het
Dhcr7 T A 7: 143,837,791 I39N probably damaging Het
Diexf A T 1: 193,114,954 M530K probably damaging Het
Dnajc13 C T 9: 104,167,387 probably benign Het
Folr2 T C 7: 101,840,290 probably null Het
Galnt11 T C 5: 25,265,338 I595T probably damaging Het
Gm884 T C 11: 103,613,460 T2561A possibly damaging Het
Gp5 G A 16: 30,309,508 A116V possibly damaging Het
Gpn3 T C 5: 122,382,240 probably benign Het
Gprin3 T C 6: 59,354,659 N221S probably benign Het
Hfm1 T C 5: 106,874,213 E989G possibly damaging Het
Ints1 T C 5: 139,758,092 probably null Het
Josd2 T C 7: 44,471,168 S110P probably damaging Het
Kat14 C A 2: 144,375,953 T123K probably damaging Het
Lamtor1 C T 7: 101,909,764 T48I probably damaging Het
Lrrc24 A G 15: 76,718,346 L113P probably damaging Het
Mog T C 17: 37,020,541 E89G probably damaging Het
Mon2 A G 10: 123,038,459 probably null Het
Mtx1 T C 3: 89,213,898 Y143C probably benign Het
Nacad T C 11: 6,598,507 E1409G possibly damaging Het
Ndst3 T C 3: 123,607,027 H410R probably damaging Het
Nkx6-2 T C 7: 139,581,570 E233G possibly damaging Het
Oas1h A G 5: 120,862,783 E152G probably damaging Het
Olfr936 A G 9: 39,046,862 S186P probably damaging Het
Ovgp1 T C 3: 105,979,953 F222L possibly damaging Het
Pkhd1 T C 1: 20,288,205 S2716G probably null Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Plxnd1 A G 6: 115,955,765 I1918T probably damaging Het
Prrxl1 G T 14: 32,608,249 Q136H probably damaging Het
Psmg1 A T 16: 95,989,612 probably benign Het
Ptprd G A 4: 76,128,899 R364C probably damaging Het
Rgs22 T C 15: 36,025,942 I945V possibly damaging Het
Rgs7bp T C 13: 104,951,564 N234S probably benign Het
Rrp7a T C 15: 83,119,809 probably benign Het
Scg2 T A 1: 79,436,476 R177* probably null Het
Sema4c C A 1: 36,550,311 C578F probably damaging Het
Slc1a5 T A 7: 16,797,743 probably benign Het
Slc5a3 A G 16: 92,078,683 T543A possibly damaging Het
Slx4ip T A 2: 137,046,767 F123I probably benign Het
Smtn C T 11: 3,522,916 R737H probably damaging Het
Stox2 A G 8: 47,413,265 I14T possibly damaging Het
Stradb T C 1: 58,980,440 F43L probably benign Het
Szt2 T C 4: 118,388,669 D1029G probably benign Het
Taar6 T C 10: 23,984,715 Y311C probably damaging Het
Tcea3 A T 4: 136,268,093 N249I probably damaging Het
Tecta A G 9: 42,330,277 M2134T probably benign Het
Tg G A 15: 66,764,337 G591D probably damaging Het
Tm4sf20 T A 1: 82,768,363 I19F probably benign Het
Top2a T C 11: 98,997,850 K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 probably benign Het
Usp29 T C 7: 6,961,928 S257P possibly damaging Het
Usp40 T C 1: 87,952,355 N1038S probably benign Het
Vmn1r121 C T 7: 21,097,613 E301K probably benign Het
Vmn2r49 T A 7: 9,989,032 H105L probably benign Het
Zgrf1 C T 3: 127,561,868 Q248* probably null Het
Other mutations in Angptl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02367:Angptl7 APN 4 148500144 missense possibly damaging 0.78
IGL02888:Angptl7 APN 4 148496331 intron probably benign
R1725:Angptl7 UTSW 4 148500012 missense probably damaging 0.96
R1772:Angptl7 UTSW 4 148497426 missense probably damaging 1.00
R1812:Angptl7 UTSW 4 148498083 missense probably damaging 0.96
R2853:Angptl7 UTSW 4 148500279 missense probably benign
R2973:Angptl7 UTSW 4 148500214 nonsense probably null
R5049:Angptl7 UTSW 4 148498011 missense probably benign 0.19
R5154:Angptl7 UTSW 4 148497425 missense probably damaging 1.00
R5725:Angptl7 UTSW 4 148496508 missense possibly damaging 0.95
R6919:Angptl7 UTSW 4 148500031 missense probably benign 0.09
R6977:Angptl7 UTSW 4 148497393 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAGCAGGCTATCCAGAAG -3'
(R):5'- TGTAGCCTTTGTCAGCCAC -3'

Sequencing Primer
(F):5'- GCTATCCAGAAGCAGAGCTG -3'
(R):5'- TTGTCAGCCACCCAGTGTG -3'
Posted On2016-04-27