Incidental Mutation 'R4944:Hfm1'
ID383337
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
MMRRC Submission 042541-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4944 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106874213 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 989 (E989G)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112690
AA Change: E989G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: E989G

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000117588
AA Change: E989G

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: E989G

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect unknown
Transcript: ENSMUST00000155171
AA Change: E202G
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410
AA Change: E202G

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,934,327 probably null Het
Angptl7 C G 4: 148,500,077 Q71H probably damaging Het
Arhgap30 A T 1: 171,402,254 N176Y probably damaging Het
Armc9 T A 1: 86,274,534 S805T probably damaging Het
Atxn1 T G 13: 45,566,931 H496P probably damaging Het
Cabin1 C T 10: 75,721,363 G1147D probably damaging Het
Cabin1 A G 10: 75,739,421 S597P probably damaging Het
Catsperd T C 17: 56,662,744 S613P probably damaging Het
Cdh2 A G 18: 16,650,409 Y88H probably damaging Het
Cntn1 C A 15: 92,228,668 P47Q probably damaging Het
Col11a2 T C 17: 34,042,190 L38P possibly damaging Het
Col5a2 T G 1: 45,376,695 I1431L possibly damaging Het
Csmd1 C T 8: 15,998,772 G2310D probably damaging Het
Dhcr7 T A 7: 143,837,791 I39N probably damaging Het
Diexf A T 1: 193,114,954 M530K probably damaging Het
Dnajc13 C T 9: 104,167,387 probably benign Het
Folr2 T C 7: 101,840,290 probably null Het
Galnt11 T C 5: 25,265,338 I595T probably damaging Het
Gm884 T C 11: 103,613,460 T2561A possibly damaging Het
Gp5 G A 16: 30,309,508 A116V possibly damaging Het
Gpn3 T C 5: 122,382,240 probably benign Het
Gprin3 T C 6: 59,354,659 N221S probably benign Het
Ints1 T C 5: 139,758,092 probably null Het
Josd2 T C 7: 44,471,168 S110P probably damaging Het
Kat14 C A 2: 144,375,953 T123K probably damaging Het
Lamtor1 C T 7: 101,909,764 T48I probably damaging Het
Lrrc24 A G 15: 76,718,346 L113P probably damaging Het
Mog T C 17: 37,020,541 E89G probably damaging Het
Mon2 A G 10: 123,038,459 probably null Het
Mtx1 T C 3: 89,213,898 Y143C probably benign Het
Nacad T C 11: 6,598,507 E1409G possibly damaging Het
Ndst3 T C 3: 123,607,027 H410R probably damaging Het
Nkx6-2 T C 7: 139,581,570 E233G possibly damaging Het
Oas1h A G 5: 120,862,783 E152G probably damaging Het
Olfr936 A G 9: 39,046,862 S186P probably damaging Het
Ovgp1 T C 3: 105,979,953 F222L possibly damaging Het
Pkhd1 T C 1: 20,288,205 S2716G probably null Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Plxnd1 A G 6: 115,955,765 I1918T probably damaging Het
Prrxl1 G T 14: 32,608,249 Q136H probably damaging Het
Psmg1 A T 16: 95,989,612 probably benign Het
Ptprd G A 4: 76,128,899 R364C probably damaging Het
Rgs22 T C 15: 36,025,942 I945V possibly damaging Het
Rgs7bp T C 13: 104,951,564 N234S probably benign Het
Rrp7a T C 15: 83,119,809 probably benign Het
Scg2 T A 1: 79,436,476 R177* probably null Het
Sema4c C A 1: 36,550,311 C578F probably damaging Het
Slc1a5 T A 7: 16,797,743 probably benign Het
Slc5a3 A G 16: 92,078,683 T543A possibly damaging Het
Slx4ip T A 2: 137,046,767 F123I probably benign Het
Smtn C T 11: 3,522,916 R737H probably damaging Het
Stox2 A G 8: 47,413,265 I14T possibly damaging Het
Stradb T C 1: 58,980,440 F43L probably benign Het
Szt2 T C 4: 118,388,669 D1029G probably benign Het
Taar6 T C 10: 23,984,715 Y311C probably damaging Het
Tcea3 A T 4: 136,268,093 N249I probably damaging Het
Tecta A G 9: 42,330,277 M2134T probably benign Het
Tg G A 15: 66,764,337 G591D probably damaging Het
Tm4sf20 T A 1: 82,768,363 I19F probably benign Het
Top2a T C 11: 98,997,850 K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 probably benign Het
Usp29 T C 7: 6,961,928 S257P possibly damaging Het
Usp40 T C 1: 87,952,355 N1038S probably benign Het
Vmn1r121 C T 7: 21,097,613 E301K probably benign Het
Vmn2r49 T A 7: 9,989,032 H105L probably benign Het
Zgrf1 C T 3: 127,561,868 Q248* probably null Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
R8739:Hfm1 UTSW 5 106898505 missense probably damaging 0.96
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATAGTGGAAGTCTGGTGC -3'
(R):5'- TGGGGTGAGAAACTTATATTAAACCTG -3'

Sequencing Primer
(F):5'- AGTTTGCAGCTGCTCAAAGTTTC -3'
(R):5'- CCTGTGAAGTCTAAGAAATGTTTCAG -3'
Posted On2016-04-27