Mutagenetix > Incidental Mutations

Incidental Mutation 'R4944:Plxnd1'

383342

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

042541-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4944 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 115955765 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1918 (I1918T)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

Predicted Effect

probably damaging
Transcript: ENSMUST00000015511
AA Change: I1918T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: I1918T

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123165

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203628

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205003

Meta Mutation Damage Score

0.2902

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (67/67)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	G	A	5: 8,934,327		probably null	Het
Angptl7	C	G	4: 148,500,077	Q71H	probably damaging	Het
Arhgap30	A	T	1: 171,402,254	N176Y	probably damaging	Het
Armc9	T	A	1: 86,274,534	S805T	probably damaging	Het
Atxn1	T	G	13: 45,566,931	H496P	probably damaging	Het
Cabin1	C	T	10: 75,721,363	G1147D	probably damaging	Het
Cabin1	A	G	10: 75,739,421	S597P	probably damaging	Het
Catsperd	T	C	17: 56,662,744	S613P	probably damaging	Het
Cdh2	A	G	18: 16,650,409	Y88H	probably damaging	Het
Cntn1	C	A	15: 92,228,668	P47Q	probably damaging	Het
Col11a2	T	C	17: 34,042,190	L38P	possibly damaging	Het
Col5a2	T	G	1: 45,376,695	I1431L	possibly damaging	Het
Csmd1	C	T	8: 15,998,772	G2310D	probably damaging	Het
Dhcr7	T	A	7: 143,837,791	I39N	probably damaging	Het
Diexf	A	T	1: 193,114,954	M530K	probably damaging	Het
Dnajc13	C	T	9: 104,167,387		probably benign	Het
Folr2	T	C	7: 101,840,290		probably null	Het
Galnt11	T	C	5: 25,265,338	I595T	probably damaging	Het
Gm884	T	C	11: 103,613,460	T2561A	possibly damaging	Het
Gp5	G	A	16: 30,309,508	A116V	possibly damaging	Het
Gpn3	T	C	5: 122,382,240		probably benign	Het
Gprin3	T	C	6: 59,354,659	N221S	probably benign	Het
Hfm1	T	C	5: 106,874,213	E989G	possibly damaging	Het
Ints1	T	C	5: 139,758,092		probably null	Het
Josd2	T	C	7: 44,471,168	S110P	probably damaging	Het
Kat14	C	A	2: 144,375,953	T123K	probably damaging	Het
Lamtor1	C	T	7: 101,909,764	T48I	probably damaging	Het
Lrrc24	A	G	15: 76,718,346	L113P	probably damaging	Het
Mog	T	C	17: 37,020,541	E89G	probably damaging	Het
Mon2	A	G	10: 123,038,459		probably null	Het
Mtx1	T	C	3: 89,213,898	Y143C	probably benign	Het
Nacad	T	C	11: 6,598,507	E1409G	possibly damaging	Het
Ndst3	T	C	3: 123,607,027	H410R	probably damaging	Het
Nkx6-2	T	C	7: 139,581,570	E233G	possibly damaging	Het
Oas1h	A	G	5: 120,862,783	E152G	probably damaging	Het
Olfr936	A	G	9: 39,046,862	S186P	probably damaging	Het
Ovgp1	T	C	3: 105,979,953	F222L	possibly damaging	Het
Pkhd1	T	C	1: 20,288,205	S2716G	probably null	Het
Pla2g4e	T	C	2: 120,171,237	T644A	probably benign	Het
Prrxl1	G	T	14: 32,608,249	Q136H	probably damaging	Het
Psmg1	A	T	16: 95,989,612		probably benign	Het
Ptprd	G	A	4: 76,128,899	R364C	probably damaging	Het
Rgs22	T	C	15: 36,025,942	I945V	possibly damaging	Het
Rgs7bp	T	C	13: 104,951,564	N234S	probably benign	Het
Rrp7a	T	C	15: 83,119,809		probably benign	Het
Scg2	T	A	1: 79,436,476	R177*	probably null	Het
Sema4c	C	A	1: 36,550,311	C578F	probably damaging	Het
Slc1a5	T	A	7: 16,797,743		probably benign	Het
Slc5a3	A	G	16: 92,078,683	T543A	possibly damaging	Het
Slx4ip	T	A	2: 137,046,767	F123I	probably benign	Het
Smtn	C	T	11: 3,522,916	R737H	probably damaging	Het
Stox2	A	G	8: 47,413,265	I14T	possibly damaging	Het
Stradb	T	C	1: 58,980,440	F43L	probably benign	Het
Szt2	T	C	4: 118,388,669	D1029G	probably benign	Het
Taar6	T	C	10: 23,984,715	Y311C	probably damaging	Het
Tcea3	A	T	4: 136,268,093	N249I	probably damaging	Het
Tecta	A	G	9: 42,330,277	M2134T	probably benign	Het
Tg	G	A	15: 66,764,337	G591D	probably damaging	Het
Tm4sf20	T	A	1: 82,768,363	I19F	probably benign	Het
Top2a	T	C	11: 98,997,850	K1262E	probably benign	Het
Ube2r2	A	G	4: 41,190,742		probably benign	Het
Usp29	T	C	7: 6,961,928	S257P	possibly damaging	Het
Usp40	T	C	1: 87,952,355	N1038S	probably benign	Het
Vmn1r121	C	T	7: 21,097,613	E301K	probably benign	Het
Vmn2r49	T	A	7: 9,989,032	H105L	probably benign	Het
Zgrf1	C	T	3: 127,561,868	Q248*	probably null	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115967972	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115969945	missense	probably benign
IGL01323:Plxnd1	APN	6	115966799	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115960527	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115959935	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115978257	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115993628	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115963913	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115955742	makesense	probably null
IGL02873:Plxnd1	APN	6	115959976	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115962357	missense	probably damaging	1.00
murmer	UTSW	6	115968793	missense	probably benign	0.00
mutter	UTSW	6	115968044	missense	probably benign	0.27
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115968793	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115969460	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115958699	splice site	probably benign
R0648:Plxnd1	UTSW	6	115994001	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115966638	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115967005	splice site	probably null
R1292:Plxnd1	UTSW	6	115962683	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115968681	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115967779	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115994057	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115980601	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115966546	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115963914	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115969441	splice site	probably null
R1865:Plxnd1	UTSW	6	115969441	splice site	probably null
R1875:Plxnd1	UTSW	6	115978084	splice site	probably null
R1899:Plxnd1	UTSW	6	115969363	missense	probably benign
R1913:Plxnd1	UTSW	6	115978017	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115962517	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115967255	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115957548	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115962764	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115964144	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115962743	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115967748	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115959315	missense	probably damaging	1.00
R4233:Plxnd1	UTSW	6	115965953	missense	probably benign	0.30
R4280:Plxnd1	UTSW	6	115956094	splice site	probably benign
R4280:Plxnd1	UTSW	6	115956095	splice site	probably null
R4346:Plxnd1	UTSW	6	115977980	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115993976	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115955756	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115968044	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115994276	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115972525	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115958615	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115958620	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115960855	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115994376	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115965901	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115958988	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115957648	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115965877	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115968688	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115967787	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115978174	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115977960	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115978492	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115976736	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115969929	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115993763	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115972507	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115960837	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115976639	missense	probably benign
R7699:Plxnd1	UTSW	6	115959794	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115966918	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115956617	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115972472	missense	probably benign
R8507:Plxnd1	UTSW	6	115966905	missense	probably damaging	0.97
X0024:Plxnd1	UTSW	6	115963310	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115966784	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115967510	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GCCTTCATCCTAGAGTTGGGTC -3'
(R):5'- CACTTTGATGAGGTCTCTGGC -3'

Sequencing Primer
(F):5'- ACAAGGCCAAGAGCTCGGC -3'
(R):5'- ATGAGGTCTCTGGCGGGTG -3'

Posted On

2016-04-27