Incidental Mutation 'R4944:Dhcr7'
ID 383351
Institutional Source Beutler Lab
Gene Symbol Dhcr7
Ensembl Gene ENSMUSG00000058454
Gene Name 7-dehydrocholesterol reductase
Synonyms
MMRRC Submission 042541-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4944 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 143376882-143402147 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143391528 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 39 (I39N)
Ref Sequence ENSEMBL: ENSMUSP00000146636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073878] [ENSMUST00000124340] [ENSMUST00000125564] [ENSMUST00000128454] [ENSMUST00000141916] [ENSMUST00000144034] [ENSMUST00000143338] [ENSMUST00000207143] [ENSMUST00000145471]
AlphaFold O88455
Predicted Effect possibly damaging
Transcript: ENSMUST00000073878
AA Change: I39N

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000073541
Gene: ENSMUSG00000058454
AA Change: I39N

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000124340
AA Change: I39N

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117659
Gene: ENSMUSG00000058454
AA Change: I39N

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125564
AA Change: I39N

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000128454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128610
Predicted Effect possibly damaging
Transcript: ENSMUST00000141916
AA Change: I39N

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121782
Gene: ENSMUSG00000058454
AA Change: I39N

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 36 471 1.5e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144034
AA Change: I39N

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000118957
Gene: ENSMUSG00000058454
AA Change: I39N

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Pfam:ERG4_ERG24 75 225 1.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143338
AA Change: I39N

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000119984
Gene: ENSMUSG00000058454
AA Change: I39N

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207143
AA Change: I42N

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208631
Predicted Effect probably benign
Transcript: ENSMUST00000145471
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that removes the C(7-8) double bond in the B ring of sterols and catalyzes the conversion of 7-dehydrocholesterol to cholesterol. This gene is ubiquitously expressed and its transmembrane protein localizes to the endoplasmic reticulum membrane and nuclear outer membrane. Mutations in this gene cause Smith-Lemli-Opitz syndrome (SLOS); a syndrome that is metabolically characterized by reduced serum cholesterol levels and elevated serum 7-dehydrocholesterol levels and phenotypically characterized by mental retardation, facial dysmorphism, syndactyly of second and third toes, and holoprosencephaly in severe cases to minimal physical abnormalities and near-normal intelligence in mild cases. Alternative splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene die within one day of birth due to respiratory and suckling problems. They exhibit abnormal cholesterol homeostasis with reduced tissue cholesterol levels and total sterol levels, enlarged bladders and sometimes cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,984,327 (GRCm39) probably null Het
Angptl7 C G 4: 148,584,534 (GRCm39) Q71H probably damaging Het
Arhgap30 A T 1: 171,229,822 (GRCm39) N176Y probably damaging Het
Armc9 T A 1: 86,202,256 (GRCm39) S805T probably damaging Het
Atxn1 T G 13: 45,720,407 (GRCm39) H496P probably damaging Het
Cabin1 C T 10: 75,557,197 (GRCm39) G1147D probably damaging Het
Cabin1 A G 10: 75,575,255 (GRCm39) S597P probably damaging Het
Catsperd T C 17: 56,969,744 (GRCm39) S613P probably damaging Het
Cdh2 A G 18: 16,783,466 (GRCm39) Y88H probably damaging Het
Cntn1 C A 15: 92,126,549 (GRCm39) P47Q probably damaging Het
Col11a2 T C 17: 34,261,164 (GRCm39) L38P possibly damaging Het
Col5a2 T G 1: 45,415,855 (GRCm39) I1431L possibly damaging Het
Csmd1 C T 8: 16,048,772 (GRCm39) G2310D probably damaging Het
Dnajc13 C T 9: 104,044,586 (GRCm39) probably benign Het
Drgx G T 14: 32,330,206 (GRCm39) Q136H probably damaging Het
Folr2 T C 7: 101,489,497 (GRCm39) probably null Het
Galnt11 T C 5: 25,470,336 (GRCm39) I595T probably damaging Het
Gp5 G A 16: 30,128,326 (GRCm39) A116V possibly damaging Het
Gpn3 T C 5: 122,520,303 (GRCm39) probably benign Het
Gprin3 T C 6: 59,331,644 (GRCm39) N221S probably benign Het
Hfm1 T C 5: 107,022,079 (GRCm39) E989G possibly damaging Het
Ints1 T C 5: 139,743,847 (GRCm39) probably null Het
Josd2 T C 7: 44,120,592 (GRCm39) S110P probably damaging Het
Kat14 C A 2: 144,217,873 (GRCm39) T123K probably damaging Het
Lamtor1 C T 7: 101,558,971 (GRCm39) T48I probably damaging Het
Lrrc24 A G 15: 76,602,546 (GRCm39) L113P probably damaging Het
Lrrc37 T C 11: 103,504,286 (GRCm39) T2561A possibly damaging Het
Mog T C 17: 37,331,433 (GRCm39) E89G probably damaging Het
Mon2 A G 10: 122,874,364 (GRCm39) probably null Het
Mtx1 T C 3: 89,121,205 (GRCm39) Y143C probably benign Het
Nacad T C 11: 6,548,507 (GRCm39) E1409G possibly damaging Het
Ndst3 T C 3: 123,400,676 (GRCm39) H410R probably damaging Het
Nkx6-2 T C 7: 139,161,486 (GRCm39) E233G possibly damaging Het
Oas1h A G 5: 121,000,846 (GRCm39) E152G probably damaging Het
Or8g22 A G 9: 38,958,158 (GRCm39) S186P probably damaging Het
Ovgp1 T C 3: 105,887,269 (GRCm39) F222L possibly damaging Het
Pkhd1 T C 1: 20,358,429 (GRCm39) S2716G probably null Het
Pla2g4e T C 2: 120,001,718 (GRCm39) T644A probably benign Het
Plxnd1 A G 6: 115,932,726 (GRCm39) I1918T probably damaging Het
Psmg1 A T 16: 95,790,812 (GRCm39) probably benign Het
Ptprd G A 4: 76,047,136 (GRCm39) R364C probably damaging Het
Rgs22 T C 15: 36,026,088 (GRCm39) I945V possibly damaging Het
Rgs7bp T C 13: 105,088,072 (GRCm39) N234S probably benign Het
Rrp7a T C 15: 83,004,010 (GRCm39) probably benign Het
Scg2 T A 1: 79,414,193 (GRCm39) R177* probably null Het
Sema4c C A 1: 36,589,392 (GRCm39) C578F probably damaging Het
Slc1a5 T A 7: 16,531,668 (GRCm39) probably benign Het
Slc5a3 A G 16: 91,875,571 (GRCm39) T543A possibly damaging Het
Slx4ip T A 2: 136,888,687 (GRCm39) F123I probably benign Het
Smtn C T 11: 3,472,916 (GRCm39) R737H probably damaging Het
Stox2 A G 8: 47,866,300 (GRCm39) I14T possibly damaging Het
Stradb T C 1: 59,019,599 (GRCm39) F43L probably benign Het
Szt2 T C 4: 118,245,866 (GRCm39) D1029G probably benign Het
Taar6 T C 10: 23,860,613 (GRCm39) Y311C probably damaging Het
Tcea3 A T 4: 135,995,404 (GRCm39) N249I probably damaging Het
Tecta A G 9: 42,241,573 (GRCm39) M2134T probably benign Het
Tg G A 15: 66,636,186 (GRCm39) G591D probably damaging Het
Tm4sf20 T A 1: 82,746,084 (GRCm39) I19F probably benign Het
Top2a T C 11: 98,888,676 (GRCm39) K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 (GRCm39) probably benign Het
Usp29 T C 7: 6,964,927 (GRCm39) S257P possibly damaging Het
Usp40 T C 1: 87,880,077 (GRCm39) N1038S probably benign Het
Utp25 A T 1: 192,797,262 (GRCm39) M530K probably damaging Het
Vmn1r121 C T 7: 20,831,538 (GRCm39) E301K probably benign Het
Vmn2r49 T A 7: 9,722,959 (GRCm39) H105L probably benign Het
Zgrf1 C T 3: 127,355,517 (GRCm39) Q248* probably null Het
Other mutations in Dhcr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Dhcr7 APN 7 143,400,805 (GRCm39) missense probably damaging 0.99
IGL01398:Dhcr7 APN 7 143,395,056 (GRCm39) missense probably damaging 0.99
IGL01668:Dhcr7 APN 7 143,397,048 (GRCm39) missense probably damaging 1.00
IGL01822:Dhcr7 APN 7 143,399,236 (GRCm39) missense probably damaging 1.00
IGL02332:Dhcr7 APN 7 143,396,865 (GRCm39) missense probably damaging 1.00
IGL03136:Dhcr7 APN 7 143,401,103 (GRCm39) missense probably damaging 1.00
IGL03334:Dhcr7 APN 7 143,394,234 (GRCm39) missense possibly damaging 0.80
R0350:Dhcr7 UTSW 7 143,391,507 (GRCm39) missense probably damaging 1.00
R0433:Dhcr7 UTSW 7 143,394,200 (GRCm39) missense possibly damaging 0.92
R0834:Dhcr7 UTSW 7 143,394,964 (GRCm39) missense probably benign 0.19
R1473:Dhcr7 UTSW 7 143,400,805 (GRCm39) missense probably damaging 0.99
R1473:Dhcr7 UTSW 7 143,395,105 (GRCm39) missense probably damaging 1.00
R1769:Dhcr7 UTSW 7 143,401,250 (GRCm39) missense probably damaging 1.00
R1773:Dhcr7 UTSW 7 143,401,195 (GRCm39) missense possibly damaging 0.87
R1997:Dhcr7 UTSW 7 143,401,167 (GRCm39) missense probably damaging 0.99
R2302:Dhcr7 UTSW 7 143,391,629 (GRCm39) missense probably benign 0.00
R4177:Dhcr7 UTSW 7 143,394,910 (GRCm39) missense probably damaging 1.00
R4275:Dhcr7 UTSW 7 143,396,964 (GRCm39) missense probably damaging 1.00
R4829:Dhcr7 UTSW 7 143,391,654 (GRCm39) missense probably damaging 1.00
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R4860:Dhcr7 UTSW 7 143,394,237 (GRCm39) missense probably benign 0.05
R5000:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.94
R5454:Dhcr7 UTSW 7 143,391,576 (GRCm39) missense probably damaging 1.00
R5633:Dhcr7 UTSW 7 143,401,160 (GRCm39) missense probably damaging 0.99
R6337:Dhcr7 UTSW 7 143,390,468 (GRCm39) critical splice donor site probably null
R6683:Dhcr7 UTSW 7 143,397,048 (GRCm39) missense probably damaging 0.99
R7175:Dhcr7 UTSW 7 143,399,227 (GRCm39) missense probably damaging 1.00
R7785:Dhcr7 UTSW 7 143,399,209 (GRCm39) missense probably damaging 1.00
R8947:Dhcr7 UTSW 7 143,400,959 (GRCm39) missense probably damaging 1.00
R9006:Dhcr7 UTSW 7 143,394,978 (GRCm39) missense probably benign
R9052:Dhcr7 UTSW 7 143,395,060 (GRCm39) missense possibly damaging 0.79
R9629:Dhcr7 UTSW 7 143,401,212 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTAAGCATCCTACCATGGGG -3'
(R):5'- CAAAGCAGTGGACTGACCTG -3'

Sequencing Primer
(F):5'- CCATGGGGTTTGAGGGAC -3'
(R):5'- TGACCCACAAGGCATACAGTTGG -3'
Posted On 2016-04-27