Incidental Mutation 'R4944:Atxn1'
ID383366
Institutional Source Beutler Lab
Gene Symbol Atxn1
Ensembl Gene ENSMUSG00000046876
Gene Nameataxin 1
Synonyms2900016G23Rik, Atx1, Sca1
MMRRC Submission 042541-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4944 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location45549755-45965008 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45566931 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 496 (H496P)
Ref Sequence ENSEMBL: ENSMUSP00000137439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091628] [ENSMUST00000167708] [ENSMUST00000180110]
Predicted Effect probably damaging
Transcript: ENSMUST00000091628
AA Change: H496P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089217
Gene: ENSMUSG00000046876
AA Change: H496P

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167708
AA Change: H496P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129890
Gene: ENSMUSG00000046876
AA Change: H496P

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 391 421 8.7e-15 PFAM
AXH 545 664 1.42e-82 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180110
AA Change: H496P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137439
Gene: ENSMUSG00000046876
AA Change: H496P

DomainStartEndE-ValueType
low complexity region 47 67 N/A INTRINSIC
low complexity region 153 168 N/A INTRINSIC
Pfam:ATXN-1_C 402 421 3e-10 PFAM
low complexity region 537 548 N/A INTRINSIC
Pfam:AXH 550 671 1.1e-44 PFAM
Meta Mutation Damage Score 0.3683 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the `pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. The function of the ataxins is not known. This locus has been mapped to chromosome 6, and it has been determined that the diseased allele contains 40-83 CAG repeats, compared to 6-39 in the normal allele, and is associated with spinocerebellar ataxia type 1 (SCA1). At least two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased exploration, impaired spatial working memory, impaired coordination, and decreased paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G A 5: 8,934,327 probably null Het
Angptl7 C G 4: 148,500,077 Q71H probably damaging Het
Arhgap30 A T 1: 171,402,254 N176Y probably damaging Het
Armc9 T A 1: 86,274,534 S805T probably damaging Het
Cabin1 C T 10: 75,721,363 G1147D probably damaging Het
Cabin1 A G 10: 75,739,421 S597P probably damaging Het
Catsperd T C 17: 56,662,744 S613P probably damaging Het
Cdh2 A G 18: 16,650,409 Y88H probably damaging Het
Cntn1 C A 15: 92,228,668 P47Q probably damaging Het
Col11a2 T C 17: 34,042,190 L38P possibly damaging Het
Col5a2 T G 1: 45,376,695 I1431L possibly damaging Het
Csmd1 C T 8: 15,998,772 G2310D probably damaging Het
Dhcr7 T A 7: 143,837,791 I39N probably damaging Het
Diexf A T 1: 193,114,954 M530K probably damaging Het
Dnajc13 C T 9: 104,167,387 probably benign Het
Folr2 T C 7: 101,840,290 probably null Het
Galnt11 T C 5: 25,265,338 I595T probably damaging Het
Gm884 T C 11: 103,613,460 T2561A possibly damaging Het
Gp5 G A 16: 30,309,508 A116V possibly damaging Het
Gpn3 T C 5: 122,382,240 probably benign Het
Gprin3 T C 6: 59,354,659 N221S probably benign Het
Hfm1 T C 5: 106,874,213 E989G possibly damaging Het
Ints1 T C 5: 139,758,092 probably null Het
Josd2 T C 7: 44,471,168 S110P probably damaging Het
Kat14 C A 2: 144,375,953 T123K probably damaging Het
Lamtor1 C T 7: 101,909,764 T48I probably damaging Het
Lrrc24 A G 15: 76,718,346 L113P probably damaging Het
Mog T C 17: 37,020,541 E89G probably damaging Het
Mon2 A G 10: 123,038,459 probably null Het
Mtx1 T C 3: 89,213,898 Y143C probably benign Het
Nacad T C 11: 6,598,507 E1409G possibly damaging Het
Ndst3 T C 3: 123,607,027 H410R probably damaging Het
Nkx6-2 T C 7: 139,581,570 E233G possibly damaging Het
Oas1h A G 5: 120,862,783 E152G probably damaging Het
Olfr936 A G 9: 39,046,862 S186P probably damaging Het
Ovgp1 T C 3: 105,979,953 F222L possibly damaging Het
Pkhd1 T C 1: 20,288,205 S2716G probably null Het
Pla2g4e T C 2: 120,171,237 T644A probably benign Het
Plxnd1 A G 6: 115,955,765 I1918T probably damaging Het
Prrxl1 G T 14: 32,608,249 Q136H probably damaging Het
Psmg1 A T 16: 95,989,612 probably benign Het
Ptprd G A 4: 76,128,899 R364C probably damaging Het
Rgs22 T C 15: 36,025,942 I945V possibly damaging Het
Rgs7bp T C 13: 104,951,564 N234S probably benign Het
Rrp7a T C 15: 83,119,809 probably benign Het
Scg2 T A 1: 79,436,476 R177* probably null Het
Sema4c C A 1: 36,550,311 C578F probably damaging Het
Slc1a5 T A 7: 16,797,743 probably benign Het
Slc5a3 A G 16: 92,078,683 T543A possibly damaging Het
Slx4ip T A 2: 137,046,767 F123I probably benign Het
Smtn C T 11: 3,522,916 R737H probably damaging Het
Stox2 A G 8: 47,413,265 I14T possibly damaging Het
Stradb T C 1: 58,980,440 F43L probably benign Het
Szt2 T C 4: 118,388,669 D1029G probably benign Het
Taar6 T C 10: 23,984,715 Y311C probably damaging Het
Tcea3 A T 4: 136,268,093 N249I probably damaging Het
Tecta A G 9: 42,330,277 M2134T probably benign Het
Tg G A 15: 66,764,337 G591D probably damaging Het
Tm4sf20 T A 1: 82,768,363 I19F probably benign Het
Top2a T C 11: 98,997,850 K1262E probably benign Het
Ube2r2 A G 4: 41,190,742 probably benign Het
Usp29 T C 7: 6,961,928 S257P possibly damaging Het
Usp40 T C 1: 87,952,355 N1038S probably benign Het
Vmn1r121 C T 7: 21,097,613 E301K probably benign Het
Vmn2r49 T A 7: 9,989,032 H105L probably benign Het
Zgrf1 C T 3: 127,561,868 Q248* probably null Het
Other mutations in Atxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Atxn1 APN 13 45568427 utr 5 prime probably benign
IGL01467:Atxn1 APN 13 45567193 missense probably damaging 1.00
IGL01482:Atxn1 APN 13 45557314 missense probably benign 0.00
IGL01512:Atxn1 APN 13 45566601 missense probably damaging 0.99
IGL01735:Atxn1 APN 13 45566722 missense probably damaging 1.00
IGL02005:Atxn1 APN 13 45568225 missense probably benign 0.00
IGL02333:Atxn1 APN 13 45567204 missense probably damaging 1.00
Cormorant UTSW 13 45557069 missense probably damaging 1.00
pelagic UTSW 13 45566812 missense probably benign 0.05
R0136:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0180:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R0299:Atxn1 UTSW 13 45567169 missense probably damaging 0.99
R0540:Atxn1 UTSW 13 45557530 missense probably damaging 1.00
R1220:Atxn1 UTSW 13 45557423 missense probably benign 0.08
R1484:Atxn1 UTSW 13 45557576 nonsense probably null
R1532:Atxn1 UTSW 13 45566910 missense possibly damaging 0.95
R1885:Atxn1 UTSW 13 45567804 missense probably benign 0.27
R2277:Atxn1 UTSW 13 45557068 missense probably damaging 0.99
R2847:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R2849:Atxn1 UTSW 13 45566699 missense probably damaging 1.00
R4326:Atxn1 UTSW 13 45965967 unclassified probably benign
R4626:Atxn1 UTSW 13 45567099 missense probably damaging 1.00
R4768:Atxn1 UTSW 13 45557548 missense probably damaging 1.00
R5011:Atxn1 UTSW 13 45557069 missense probably damaging 1.00
R5061:Atxn1 UTSW 13 45557093 missense probably damaging 1.00
R5293:Atxn1 UTSW 13 45568368 missense probably damaging 1.00
R5299:Atxn1 UTSW 13 45557254 missense probably benign 0.14
R5561:Atxn1 UTSW 13 45566871 missense possibly damaging 0.49
R5667:Atxn1 UTSW 13 45557377 missense probably benign 0.17
R6092:Atxn1 UTSW 13 45566812 missense probably benign 0.05
R6272:Atxn1 UTSW 13 45567762 missense possibly damaging 0.49
R6372:Atxn1 UTSW 13 45557456 missense probably damaging 1.00
R6688:Atxn1 UTSW 13 45567671 missense probably damaging 0.99
R6997:Atxn1 UTSW 13 45567619 missense probably benign 0.04
R7041:Atxn1 UTSW 13 45566835 missense probably damaging 1.00
R7578:Atxn1 UTSW 13 45567358 missense probably benign 0.02
R7600:Atxn1 UTSW 13 45557060 missense possibly damaging 0.90
R8112:Atxn1 UTSW 13 45567957 missense probably benign
R8297:Atxn1 UTSW 13 45567029 missense probably benign
R8411:Atxn1 UTSW 13 45566556 missense probably benign 0.02
R8482:Atxn1 UTSW 13 45567950 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CATGAAATATGGCGGCAGC -3'
(R):5'- ACACAGTGCATCAGAGCCTC -3'

Sequencing Primer
(F):5'- ATATGGCGGCAGCGTGGG -3'
(R):5'- CCTGTCATCGGCTACCTGAG -3'
Posted On2016-04-27