Incidental Mutation 'R4946:Plcb1'
ID383392
Institutional Source Beutler Lab
Gene Symbol Plcb1
Ensembl Gene ENSMUSG00000051177
Gene Namephospholipase C, beta 1
Synonyms3110043I21Rik
MMRRC Submission 042543-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R4946 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location134786067-135475258 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135345095 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 761 (I761V)
Ref Sequence ENSEMBL: ENSMUSP00000118756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]
Predicted Effect probably benign
Transcript: ENSMUST00000070724
AA Change: I761V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: I761V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 2.2e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.3e-7 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 997 1155 1.9e-64 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110116
AA Change: I761V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: I761V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 4.1e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1.1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1176 2.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131552
AA Change: I761V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: I761V

DomainStartEndE-ValueType
Pfam:EF-hand_like 224 315 3.9e-26 PFAM
PLCXc 316 467 2.85e-74 SMART
low complexity region 491 501 N/A INTRINSIC
PLCYc 540 656 2e-69 SMART
C2 677 776 1.55e-12 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:DUF1154 903 946 1e-9 PFAM
low complexity region 967 984 N/A INTRINSIC
Pfam:PLC-beta_C 1003 1148 8e-51 PFAM
low complexity region 1157 1168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153402
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Adgre1 G A 17: 57,443,918 V531I probably benign Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank2 A T 3: 126,941,940 probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Krt77 T C 15: 101,869,563 Y19C unknown Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Mtmr6 C T 14: 60,280,189 P83L possibly damaging Het
Myh3 T C 11: 67,093,538 I1067T probably benign Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr467 A G 7: 107,815,382 H266R possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Pparg A G 6: 115,451,028 K159E probably damaging Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Zfp516 T C 18: 82,956,094 I139T probably benign Het
Other mutations in Plcb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Plcb1 APN 2 135251756 missense possibly damaging 0.66
IGL01152:Plcb1 APN 2 134813659 missense probably damaging 1.00
IGL01945:Plcb1 APN 2 135220791 missense probably benign 0.03
IGL01999:Plcb1 APN 2 135346318 missense probably damaging 1.00
IGL02109:Plcb1 APN 2 134786559 missense probably damaging 1.00
IGL02153:Plcb1 APN 2 135387853 missense probably benign 0.08
IGL02207:Plcb1 APN 2 135387171 missense probably damaging 1.00
IGL02566:Plcb1 APN 2 135472263 missense probably benign 0.17
IGL02590:Plcb1 APN 2 135294864 missense probably benign 0.08
IGL02640:Plcb1 APN 2 135220859 splice site probably benign
IGL02926:Plcb1 APN 2 135364762 splice site probably benign
IGL03071:Plcb1 APN 2 135387802 missense probably damaging 1.00
IGL03236:Plcb1 APN 2 135346306 missense probably damaging 1.00
IGL03252:Plcb1 APN 2 135370428 missense probably benign
IGL03387:Plcb1 APN 2 134813686 splice site probably benign
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0024:Plcb1 UTSW 2 135362425 missense probably benign 0.06
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0053:Plcb1 UTSW 2 135294915 missense probably benign 0.33
R0308:Plcb1 UTSW 2 134813614 missense probably benign 0.01
R0415:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
R0624:Plcb1 UTSW 2 135294911 missense possibly damaging 0.81
R0898:Plcb1 UTSW 2 135387143 missense possibly damaging 0.73
R1071:Plcb1 UTSW 2 135325657 missense possibly damaging 0.64
R1615:Plcb1 UTSW 2 135362444 splice site probably benign
R1617:Plcb1 UTSW 2 135337441 missense probably damaging 1.00
R1785:Plcb1 UTSW 2 135325667 nonsense probably null
R1866:Plcb1 UTSW 2 135344173 missense probably benign 0.01
R1869:Plcb1 UTSW 2 135311014 missense probably benign 0.02
R1902:Plcb1 UTSW 2 134813613 missense possibly damaging 0.93
R1938:Plcb1 UTSW 2 135386302 missense probably damaging 1.00
R2016:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2017:Plcb1 UTSW 2 135362420 missense possibly damaging 0.94
R2131:Plcb1 UTSW 2 135325667 nonsense probably null
R2132:Plcb1 UTSW 2 135325667 nonsense probably null
R2133:Plcb1 UTSW 2 135325667 nonsense probably null
R2164:Plcb1 UTSW 2 135346330 missense possibly damaging 0.87
R2419:Plcb1 UTSW 2 135262100 splice site probably benign
R2429:Plcb1 UTSW 2 135337442 missense probably damaging 0.99
R2508:Plcb1 UTSW 2 135260508 missense probably benign 0.27
R3161:Plcb1 UTSW 2 135335482 missense probably benign 0.03
R3870:Plcb1 UTSW 2 135325671 missense probably damaging 0.99
R4191:Plcb1 UTSW 2 135345090 missense probably damaging 1.00
R4239:Plcb1 UTSW 2 135344158 missense probably damaging 0.99
R4552:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4553:Plcb1 UTSW 2 135335493 missense probably benign 0.44
R4720:Plcb1 UTSW 2 135251747 missense possibly damaging 0.70
R5012:Plcb1 UTSW 2 135333400 missense probably null 0.97
R5151:Plcb1 UTSW 2 135262245 missense probably benign 0.28
R5320:Plcb1 UTSW 2 135252776 missense possibly damaging 0.56
R5415:Plcb1 UTSW 2 135347402 missense possibly damaging 0.67
R5523:Plcb1 UTSW 2 135260566 missense probably benign 0.08
R5568:Plcb1 UTSW 2 135370593 missense probably damaging 1.00
R5688:Plcb1 UTSW 2 135335480 missense probably benign 0.06
R5809:Plcb1 UTSW 2 135262244 missense possibly damaging 0.83
R6237:Plcb1 UTSW 2 135370566 missense possibly damaging 0.94
R6315:Plcb1 UTSW 2 135346341 missense probably benign 0.00
R6478:Plcb1 UTSW 2 135335451 missense probably damaging 1.00
R6531:Plcb1 UTSW 2 135325802 critical splice donor site probably null
R6683:Plcb1 UTSW 2 134786593 missense probably benign 0.32
R6760:Plcb1 UTSW 2 135472060 missense possibly damaging 0.50
R6947:Plcb1 UTSW 2 135386155 missense probably benign 0.08
R6976:Plcb1 UTSW 2 135262239 missense possibly damaging 0.75
R7379:Plcb1 UTSW 2 135370510 missense probably benign 0.45
R7473:Plcb1 UTSW 2 135344276 missense probably damaging 0.98
R7492:Plcb1 UTSW 2 135251764 nonsense probably null
R7498:Plcb1 UTSW 2 135262233 nonsense probably null
R7498:Plcb1 UTSW 2 135262234 missense probably damaging 0.99
R7777:Plcb1 UTSW 2 135220757 missense possibly damaging 0.51
R8061:Plcb1 UTSW 2 135346396 missense probably benign
S24628:Plcb1 UTSW 2 135337499 missense probably damaging 1.00
X0025:Plcb1 UTSW 2 135345054 missense possibly damaging 0.87
Z1088:Plcb1 UTSW 2 135220846 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TTTCTTACAACACAGAGAGGCAAC -3'
(R):5'- ACTTTTACAGCACAGCAACATG -3'

Sequencing Primer
(F):5'- CAGGGCCAGCTTTTCTAA -3'
(R):5'- TTTTACAGCACAGCAACATGACAAAC -3'
Posted On2016-04-27