Mutagenetix > Incidental Mutations

Incidental Mutation 'R4946:Plcb1'

383392

Institutional Source

Beutler Lab

Gene Symbol

Plcb1

Ensembl Gene

ENSMUSG00000051177

Gene Name

phospholipase C, beta 1

Synonyms

3110043I21Rik

MMRRC Submission

042543-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.212) question?

Stock #

R4946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134786067-135475258 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135345095 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 761 (I761V)

Ref Sequence

ENSEMBL: ENSMUSP00000118756 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070724] [ENSMUST00000110116] [ENSMUST00000131552]

AlphaFold

Q9Z1B3

Predicted Effect

probably benign
Transcript: ENSMUST00000070724
AA Change: I761V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000064844
Gene: ENSMUSG00000051177
AA Change: I761V

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	2.2e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.3e-7	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	997	1155	1.9e-64	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110116
AA Change: I761V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000105743
Gene: ENSMUSG00000051177
AA Change: I761V

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	4.1e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1.1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1176	2.9e-61	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131552
AA Change: I761V

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000118756
Gene: ENSMUSG00000051177
AA Change: I761V

Domain	Start	End	E-Value	Type
Pfam:EF-hand_like	224	315	3.9e-26	PFAM
PLCXc	316	467	2.85e-74	SMART
low complexity region	491	501	N/A	INTRINSIC
PLCYc	540	656	2e-69	SMART
C2	677	776	1.55e-12	SMART
low complexity region	871	885	N/A	INTRINSIC
Pfam:DUF1154	903	946	1e-9	PFAM
low complexity region	967	984	N/A	INTRINSIC
Pfam:PLC-beta_C	1003	1148	8e-51	PFAM
low complexity region	1157	1168	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153402

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of many extracellular signals. This gene is activated by two G-protein alpha subunits, alpha-q and alpha-11. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit spontaneous seizures and high mortality around 3 weeks of age. Mutant males show exhibit sperm with a reduced acrosome reaction rate and fertilizing capacity in vitro and decreased fertility in vivo. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,086,474	D98G	probably damaging	Het
Adgre1	G	A	17: 57,443,918	V531I	probably benign	Het
Aldoart2	A	G	12: 55,566,016	Q242R	probably benign	Het
Ank2	A	T	3: 126,941,940		probably benign	Het
Ank3	C	T	10: 69,898,117	A737V	probably damaging	Het
Ankle2	A	G	5: 110,253,838	I789V	probably benign	Het
Ankrd13c	T	C	3: 158,005,773	V510A	probably damaging	Het
Arid1b	T	A	17: 5,342,843	M2216K	probably damaging	Het
Arrdc1	A	G	2: 24,925,848	V380A	probably benign	Het
B3galt1	C	A	2: 68,118,569	N209K	possibly damaging	Het
Cd300c2	A	T	11: 114,996,905	C224S	probably benign	Het
Cdk4	T	C	10: 127,064,890		probably null	Het
Cdk5rap1	T	C	2: 154,368,874	T115A	possibly damaging	Het
Clvs1	A	T	4: 9,281,831	R92*	probably null	Het
Cnga1	A	G	5: 72,604,764	V469A	probably damaging	Het
Ctns	A	G	11: 73,196,653	F16L	probably benign	Het
Dlg5	A	T	14: 24,154,361	C1299S	probably damaging	Het
Dnah3	T	A	7: 119,931,560	Y3690F	probably damaging	Het
Dnah5	A	G	15: 28,326,557	M1971V	probably damaging	Het
Dnah5	G	A	15: 28,387,904	V3170M	probably damaging	Het
Dpp8	T	C	9: 65,055,918	Y485H	probably benign	Het
Dsc2	T	C	18: 20,050,157	D68G	probably damaging	Het
Elavl1	A	T	8: 4,301,752	D121E	probably benign	Het
Ermap	A	G	4: 119,183,308	V311A	probably damaging	Het
Fam102b	A	G	3: 108,980,228	V240A	probably benign	Het
Fbxw11	C	T	11: 32,739,226	R437C	probably damaging	Het
Gas2l3	T	C	10: 89,413,772	M495V	probably benign	Het
Hacd1	C	T	2: 14,045,137		probably null	Het
Itgav	A	G	2: 83,788,983	R596G	probably benign	Het
Kars	T	C	8: 112,001,720	H215R	possibly damaging	Het
Kif26a	G	A	12: 112,177,794	R1494H	probably damaging	Het
Klf12	G	A	14: 100,022,957	S112L	possibly damaging	Het
Krt77	T	C	15: 101,869,563	Y19C	unknown	Het
Lrrc4c	A	G	2: 97,630,489	T487A	probably benign	Het
Lrrn1	A	G	6: 107,568,890	M550V	probably benign	Het
Lsr	C	A	7: 30,958,209	R442L	probably benign	Het
Lysmd2	A	C	9: 75,635,446	T112P	probably damaging	Het
Mctp2	A	T	7: 72,259,269	S99T	probably benign	Het
Mettl4	A	G	17: 94,740,532	V227A	probably benign	Het
Mill2	T	A	7: 18,856,683		probably null	Het
Mpp3	T	C	11: 102,005,022	N476D	probably benign	Het
Mtmr6	C	T	14: 60,280,189	P83L	possibly damaging	Het
Myh3	T	C	11: 67,093,538	I1067T	probably benign	Het
Myh9	C	A	15: 77,773,340	Q1068H	probably damaging	Het
Narf	T	A	11: 121,250,353	H304Q	possibly damaging	Het
Nfatc2ip	G	T	7: 126,396,612	P35Q	possibly damaging	Het
Npas3	C	A	12: 54,065,835	P426Q	probably damaging	Het
Olfr1289	T	C	2: 111,483,966	Y207H	possibly damaging	Het
Olfr1508	G	A	14: 52,463,283	T242I	probably damaging	Het
Olfr432	T	G	1: 174,050,834	S154A	possibly damaging	Het
Olfr467	A	G	7: 107,815,382	H266R	possibly damaging	Het
Olfr640	T	A	7: 104,022,012	Q102L	probably damaging	Het
Pcdh10	A	T	3: 45,379,482	E77V	probably damaging	Het
Pcnt	C	T	10: 76,356,185	R2764Q	probably damaging	Het
Pgbd5	T	C	8: 124,370,585	D493G	possibly damaging	Het
Piezo2	G	T	18: 63,157,262	T142N	probably benign	Het
Plekhg4	T	G	8: 105,381,996	D1196E	probably null	Het
Pparg	A	G	6: 115,451,028	K159E	probably damaging	Het
Psmb1	A	T	17: 15,498,216	M16K	probably benign	Het
Ptprq	T	C	10: 107,525,734	I2139V	probably benign	Het
Ralgapb	T	A	2: 158,440,967	S239T	probably damaging	Het
Serpina11	A	G	12: 103,984,664	V266A	probably damaging	Het
Sf3a2	C	G	10: 80,804,113		probably benign	Het
Smim18	T	C	8: 33,742,559	T11A	possibly damaging	Het
Snx6	G	A	12: 54,770,743	T7I	probably damaging	Het
Srcin1	T	A	11: 97,551,942	D75V	probably damaging	Het
Srsf12	T	A	4: 33,231,174	S223T	probably damaging	Het
Taf4b	G	T	18: 14,813,542	C474F	probably damaging	Het
Tango6	T	A	8: 106,718,090	C542*	probably null	Het
Tbc1d24	A	G	17: 24,208,536	S151P	possibly damaging	Het
Tssk6	T	C	8: 69,903,064	S253P	probably benign	Het
Ttc39c	G	A	18: 12,724,942	W300*	probably null	Het
Ttc6	T	A	12: 57,643,140	W539R	probably benign	Het
Ttn	T	C	2: 76,752,426	T22708A	probably damaging	Het
Ttn	C	A	2: 76,918,709	E3999*	probably null	Het
Vill	T	G	9: 119,068,440	L261R	probably damaging	Het
Vmn1r20	T	C	6: 57,432,174	S162P	probably damaging	Het
Zfp516	T	C	18: 82,956,094	I139T	probably benign	Het

Other mutations in Plcb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00510:Plcb1	APN	2	135251756	missense	possibly damaging	0.66
IGL01152:Plcb1	APN	2	134813659	missense	probably damaging	1.00
IGL01945:Plcb1	APN	2	135220791	missense	probably benign	0.03
IGL01999:Plcb1	APN	2	135346318	missense	probably damaging	1.00
IGL02109:Plcb1	APN	2	134786559	missense	probably damaging	1.00
IGL02153:Plcb1	APN	2	135387853	missense	probably benign	0.08
IGL02207:Plcb1	APN	2	135387171	missense	probably damaging	1.00
IGL02566:Plcb1	APN	2	135472263	missense	probably benign	0.17
IGL02590:Plcb1	APN	2	135294864	missense	probably benign	0.08
IGL02640:Plcb1	APN	2	135220859	splice site	probably benign
IGL02926:Plcb1	APN	2	135364762	splice site	probably benign
IGL03071:Plcb1	APN	2	135387802	missense	probably damaging	1.00
IGL03236:Plcb1	APN	2	135346306	missense	probably damaging	1.00
IGL03252:Plcb1	APN	2	135370428	missense	probably benign
IGL03387:Plcb1	APN	2	134813686	splice site	probably benign
BB001:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
BB011:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0024:Plcb1	UTSW	2	135362425	missense	probably benign	0.06
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0053:Plcb1	UTSW	2	135294915	missense	probably benign	0.33
R0308:Plcb1	UTSW	2	134813614	missense	probably benign	0.01
R0415:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
R0624:Plcb1	UTSW	2	135294911	missense	possibly damaging	0.81
R0898:Plcb1	UTSW	2	135387143	missense	possibly damaging	0.73
R1071:Plcb1	UTSW	2	135325657	missense	possibly damaging	0.64
R1615:Plcb1	UTSW	2	135362444	splice site	probably benign
R1617:Plcb1	UTSW	2	135337441	missense	probably damaging	1.00
R1785:Plcb1	UTSW	2	135325667	nonsense	probably null
R1866:Plcb1	UTSW	2	135344173	missense	probably benign	0.01
R1869:Plcb1	UTSW	2	135311014	missense	probably benign	0.02
R1902:Plcb1	UTSW	2	134813613	missense	possibly damaging	0.93
R1938:Plcb1	UTSW	2	135386302	missense	probably damaging	1.00
R2016:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2017:Plcb1	UTSW	2	135362420	missense	possibly damaging	0.94
R2131:Plcb1	UTSW	2	135325667	nonsense	probably null
R2132:Plcb1	UTSW	2	135325667	nonsense	probably null
R2133:Plcb1	UTSW	2	135325667	nonsense	probably null
R2164:Plcb1	UTSW	2	135346330	missense	possibly damaging	0.87
R2419:Plcb1	UTSW	2	135262100	splice site	probably benign
R2429:Plcb1	UTSW	2	135337442	missense	probably damaging	0.99
R2508:Plcb1	UTSW	2	135260508	missense	probably benign	0.27
R3161:Plcb1	UTSW	2	135335482	missense	probably benign	0.03
R3870:Plcb1	UTSW	2	135325671	missense	probably damaging	0.99
R4191:Plcb1	UTSW	2	135345090	missense	probably damaging	1.00
R4239:Plcb1	UTSW	2	135344158	missense	probably damaging	0.99
R4552:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4553:Plcb1	UTSW	2	135335493	missense	probably benign	0.44
R4720:Plcb1	UTSW	2	135251747	missense	possibly damaging	0.70
R5012:Plcb1	UTSW	2	135333400	missense	probably null	0.97
R5151:Plcb1	UTSW	2	135262245	missense	probably benign	0.28
R5320:Plcb1	UTSW	2	135252776	missense	possibly damaging	0.56
R5415:Plcb1	UTSW	2	135347402	missense	possibly damaging	0.67
R5523:Plcb1	UTSW	2	135260566	missense	probably benign	0.08
R5568:Plcb1	UTSW	2	135370593	missense	probably damaging	1.00
R5688:Plcb1	UTSW	2	135335480	missense	probably benign	0.06
R5809:Plcb1	UTSW	2	135262244	missense	possibly damaging	0.83
R6237:Plcb1	UTSW	2	135370566	missense	possibly damaging	0.94
R6315:Plcb1	UTSW	2	135346341	missense	probably benign	0.00
R6478:Plcb1	UTSW	2	135335451	missense	probably damaging	1.00
R6531:Plcb1	UTSW	2	135325802	critical splice donor site	probably null
R6683:Plcb1	UTSW	2	134786593	missense	probably benign	0.32
R6760:Plcb1	UTSW	2	135472060	missense	possibly damaging	0.50
R6947:Plcb1	UTSW	2	135386155	missense	probably benign	0.08
R6976:Plcb1	UTSW	2	135262239	missense	possibly damaging	0.75
R7379:Plcb1	UTSW	2	135370510	missense	probably benign	0.45
R7473:Plcb1	UTSW	2	135344276	missense	probably damaging	0.98
R7492:Plcb1	UTSW	2	135251764	nonsense	probably null
R7498:Plcb1	UTSW	2	135262233	nonsense	probably null
R7498:Plcb1	UTSW	2	135262234	missense	probably damaging	0.99
R7777:Plcb1	UTSW	2	135220757	missense	possibly damaging	0.51
R7924:Plcb1	UTSW	2	135359693	missense	probably benign	0.00
R8061:Plcb1	UTSW	2	135346396	missense	probably benign
R8099:Plcb1	UTSW	2	135251734	missense	possibly damaging	0.68
R8299:Plcb1	UTSW	2	135335476	missense	probably damaging	1.00
R8394:Plcb1	UTSW	2	135317790	missense	probably damaging	1.00
R8439:Plcb1	UTSW	2	135250052	critical splice donor site	probably null
R8549:Plcb1	UTSW	2	135364933	missense	probably benign	0.00
R8693:Plcb1	UTSW	2	135252776	missense	probably benign	0.00
R8750:Plcb1	UTSW	2	135335449	missense	probably damaging	1.00
R8817:Plcb1	UTSW	2	135333509	intron	probably benign
R8950:Plcb1	UTSW	2	135337519	missense	probably damaging	1.00
R9146:Plcb1	UTSW	2	135340695	missense	probably damaging	1.00
R9301:Plcb1	UTSW	2	135325690	missense	possibly damaging	0.96
R9311:Plcb1	UTSW	2	135347465	missense	probably benign	0.00
S24628:Plcb1	UTSW	2	135337499	missense	probably damaging	1.00
X0025:Plcb1	UTSW	2	135345054	missense	possibly damaging	0.87
Z1088:Plcb1	UTSW	2	135220846	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- TTTCTTACAACACAGAGAGGCAAC -3'
(R):5'- ACTTTTACAGCACAGCAACATG -3'

Sequencing Primer
(F):5'- CAGGGCCAGCTTTTCTAA -3'
(R):5'- TTTTACAGCACAGCAACATGACAAAC -3'

Posted On

2016-04-27