Incidental Mutation 'R4946:Pparg'
ID383408
Institutional Source Beutler Lab
Gene Symbol Pparg
Ensembl Gene ENSMUSG00000000440
Gene Nameperoxisome proliferator activated receptor gamma
SynonymsPpar-gamma2, PPAR-gamma, Nr1c3, PPARgamma, PPARgamma2
MMRRC Submission 042543-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4946 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location115360951-115490399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115451028 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 159 (K159E)
Ref Sequence ENSEMBL: ENSMUSP00000144975 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000450] [ENSMUST00000171644] [ENSMUST00000203732] [ENSMUST00000205213]
Predicted Effect probably damaging
Transcript: ENSMUST00000000450
AA Change: K189E

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000000450
Gene: ENSMUSG00000000440
AA Change: K189E

DomainStartEndE-ValueType
Pfam:PPARgamma_N 31 108 1.1e-35 PFAM
ZnF_C4 136 206 2.61e-34 SMART
HOLI 315 474 9.89e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171644
AA Change: K159E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131962
Gene: ENSMUSG00000000440
AA Change: K159E

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 3.1e-36 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000203732
AA Change: K159E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145525
Gene: ENSMUSG00000000440
AA Change: K159E

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 2e-35 PFAM
ZnF_C4 106 176 2.61e-34 SMART
HOLI 285 444 9.89e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204889
Predicted Effect probably damaging
Transcript: ENSMUST00000205213
AA Change: K159E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144975
Gene: ENSMUSG00000000440
AA Change: K159E

DomainStartEndE-ValueType
Pfam:PPARgamma_N 1 78 7.1e-33 PFAM
ZnF_C4 106 176 1.1e-36 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a nuclear receptor protein belonging to the peroxisome proliferator-activated receptor (Ppar) family. The encoded protein is a ligand-activated transcription factor that is involved in the regulation of adipocyte differentiation and glucose homeostasis. The encoded protein forms a heterodimer with retinoid X receptors and binds to DNA motifs termed "peroxisome proliferator response elements" to either activate or inhibit gene expression. Mice lacking the encoded protein die at an embryonic stage due to severe defects in placental vascularization. When the embryos lacking this gene are supplemented with healthy placentas, the mutants survive to term, but succumb to lipodystrophy and multiple hemorrhages. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lethality due to placental defects. Heterozygotes show greater B cell proliferation, enhanced leptin secretion, and resistance to diet-induced adipocyte hypertrophy and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Adgre1 G A 17: 57,443,918 V531I probably benign Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank2 A T 3: 126,941,940 probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Krt77 T C 15: 101,869,563 Y19C unknown Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Mtmr6 C T 14: 60,280,189 P83L possibly damaging Het
Myh3 T C 11: 67,093,538 I1067T probably benign Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr467 A G 7: 107,815,382 H266R possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plcb1 A G 2: 135,345,095 I761V probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Zfp516 T C 18: 82,956,094 I139T probably benign Het
Other mutations in Pparg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Pparg APN 6 115439861 missense probably damaging 0.99
IGL00938:Pparg APN 6 115463139 missense probably benign 0.09
IGL01303:Pparg APN 6 115472954 missense possibly damaging 0.89
IGL01454:Pparg APN 6 115439939 missense probably damaging 1.00
IGL01552:Pparg APN 6 115490122 missense probably benign 0.00
IGL02998:Pparg APN 6 115463088 missense probably benign 0.01
IGL03167:Pparg APN 6 115473227 missense probably damaging 1.00
IGL03179:Pparg APN 6 115439872 missense probably damaging 1.00
Energy UTSW 6 115451044 missense probably damaging 1.00
R1083:Pparg UTSW 6 115490146 missense probably damaging 0.99
R1569:Pparg UTSW 6 115439999 missense probably benign 0.14
R1620:Pparg UTSW 6 115473281 missense probably benign 0.01
R1850:Pparg UTSW 6 115450980 missense probably damaging 1.00
R2339:Pparg UTSW 6 115451044 missense probably damaging 1.00
R4429:Pparg UTSW 6 115440023 missense probably benign 0.09
R4941:Pparg UTSW 6 115490110 missense probably damaging 1.00
R5110:Pparg UTSW 6 115473003 missense probably damaging 1.00
R5523:Pparg UTSW 6 115490071 missense probably damaging 1.00
R6900:Pparg UTSW 6 115472988 missense possibly damaging 0.87
R6994:Pparg UTSW 6 115451050 missense probably benign 0.36
R7177:Pparg UTSW 6 115441620 missense probably benign 0.40
R7755:Pparg UTSW 6 115463106 missense probably damaging 1.00
R8103:Pparg UTSW 6 115473141 missense possibly damaging 0.91
X0064:Pparg UTSW 6 115439914 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCACTTTTGCTGATGTCCAAG -3'
(R):5'- TACACGAAGAAGCTCTCATCAGG -3'

Sequencing Primer
(F):5'- CTGATGTCCAAGTCAATGAGTGTC -3'
(R):5'- GAAGCTCTCATCAGGATGACTTTG -3'
Posted On2016-04-27