Mutagenetix > Incidental Mutations

Incidental Mutation 'R4946:Mill2'

383409

Institutional Source

Beutler Lab

Gene Symbol

Mill2

Ensembl Gene

ENSMUSG00000040987

Gene Name

MHC I like leukocyte 2

Synonyms

MMRRC Submission

042543-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R4946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18839966-18865402 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 18856683 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154268 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072386] [ENSMUST00000072415] [ENSMUST00000206487] [ENSMUST00000227379] [ENSMUST00000228493]

Predicted Effect

probably null
Transcript: ENSMUST00000072386

SMART Domains

Protein: ENSMUSP00000072223
Gene: ENSMUSG00000040987

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:MHC_I_3	39	224	2.5e-14	PFAM
Pfam:MHC_I	49	225	1.5e-33	PFAM
IGc1	244	316	7.82e-6	SMART
low complexity region	332	354	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000072415

SMART Domains

Protein: ENSMUSP00000072246
Gene: ENSMUSG00000040987

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:MHC_I	34	210	5.9e-33	PFAM
IGc1	229	301	7.82e-6	SMART
low complexity region	317	339	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206487

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207014

Predicted Effect

probably null
Transcript: ENSMUST00000227379

Predicted Effect

probably null
Transcript: ENSMUST00000228493

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavily glycosylated protein which is a ligand for the NKG2D type II receptor. Binding of the ligand activates the cytolytic response of natural killer (NK) cells, CD8 alphabeta T cells, and gammadelta T cells which express the receptor. This protein is stress-induced and is similar to MHC class I molecules; however, it does not associate with beta-2-microglobulin or bind peptides. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,086,474	D98G	probably damaging	Het
Adgre1	G	A	17: 57,443,918	V531I	probably benign	Het
Aldoart2	A	G	12: 55,566,016	Q242R	probably benign	Het
Ank2	A	T	3: 126,941,940		probably benign	Het
Ank3	C	T	10: 69,898,117	A737V	probably damaging	Het
Ankle2	A	G	5: 110,253,838	I789V	probably benign	Het
Ankrd13c	T	C	3: 158,005,773	V510A	probably damaging	Het
Arid1b	T	A	17: 5,342,843	M2216K	probably damaging	Het
Arrdc1	A	G	2: 24,925,848	V380A	probably benign	Het
B3galt1	C	A	2: 68,118,569	N209K	possibly damaging	Het
Cd300c2	A	T	11: 114,996,905	C224S	probably benign	Het
Cdk4	T	C	10: 127,064,890		probably null	Het
Cdk5rap1	T	C	2: 154,368,874	T115A	possibly damaging	Het
Clvs1	A	T	4: 9,281,831	R92*	probably null	Het
Cnga1	A	G	5: 72,604,764	V469A	probably damaging	Het
Ctns	A	G	11: 73,196,653	F16L	probably benign	Het
Dlg5	A	T	14: 24,154,361	C1299S	probably damaging	Het
Dnah3	T	A	7: 119,931,560	Y3690F	probably damaging	Het
Dnah5	A	G	15: 28,326,557	M1971V	probably damaging	Het
Dnah5	G	A	15: 28,387,904	V3170M	probably damaging	Het
Dpp8	T	C	9: 65,055,918	Y485H	probably benign	Het
Dsc2	T	C	18: 20,050,157	D68G	probably damaging	Het
Elavl1	A	T	8: 4,301,752	D121E	probably benign	Het
Ermap	A	G	4: 119,183,308	V311A	probably damaging	Het
Fam102b	A	G	3: 108,980,228	V240A	probably benign	Het
Fbxw11	C	T	11: 32,739,226	R437C	probably damaging	Het
Gas2l3	T	C	10: 89,413,772	M495V	probably benign	Het
Hacd1	C	T	2: 14,045,137		probably null	Het
Itgav	A	G	2: 83,788,983	R596G	probably benign	Het
Kars	T	C	8: 112,001,720	H215R	possibly damaging	Het
Kif26a	G	A	12: 112,177,794	R1494H	probably damaging	Het
Klf12	G	A	14: 100,022,957	S112L	possibly damaging	Het
Krt77	T	C	15: 101,869,563	Y19C	unknown	Het
Lrrc4c	A	G	2: 97,630,489	T487A	probably benign	Het
Lrrn1	A	G	6: 107,568,890	M550V	probably benign	Het
Lsr	C	A	7: 30,958,209	R442L	probably benign	Het
Lysmd2	A	C	9: 75,635,446	T112P	probably damaging	Het
Mctp2	A	T	7: 72,259,269	S99T	probably benign	Het
Mettl4	A	G	17: 94,740,532	V227A	probably benign	Het
Mpp3	T	C	11: 102,005,022	N476D	probably benign	Het
Mtmr6	C	T	14: 60,280,189	P83L	possibly damaging	Het
Myh3	T	C	11: 67,093,538	I1067T	probably benign	Het
Myh9	C	A	15: 77,773,340	Q1068H	probably damaging	Het
Narf	T	A	11: 121,250,353	H304Q	possibly damaging	Het
Nfatc2ip	G	T	7: 126,396,612	P35Q	possibly damaging	Het
Npas3	C	A	12: 54,065,835	P426Q	probably damaging	Het
Olfr1289	T	C	2: 111,483,966	Y207H	possibly damaging	Het
Olfr1508	G	A	14: 52,463,283	T242I	probably damaging	Het
Olfr432	T	G	1: 174,050,834	S154A	possibly damaging	Het
Olfr467	A	G	7: 107,815,382	H266R	possibly damaging	Het
Olfr640	T	A	7: 104,022,012	Q102L	probably damaging	Het
Pcdh10	A	T	3: 45,379,482	E77V	probably damaging	Het
Pcnt	C	T	10: 76,356,185	R2764Q	probably damaging	Het
Pgbd5	T	C	8: 124,370,585	D493G	possibly damaging	Het
Piezo2	G	T	18: 63,157,262	T142N	probably benign	Het
Plcb1	A	G	2: 135,345,095	I761V	probably benign	Het
Plekhg4	T	G	8: 105,381,996	D1196E	probably null	Het
Pparg	A	G	6: 115,451,028	K159E	probably damaging	Het
Psmb1	A	T	17: 15,498,216	M16K	probably benign	Het
Ptprq	T	C	10: 107,525,734	I2139V	probably benign	Het
Ralgapb	T	A	2: 158,440,967	S239T	probably damaging	Het
Serpina11	A	G	12: 103,984,664	V266A	probably damaging	Het
Sf3a2	C	G	10: 80,804,113		probably benign	Het
Smim18	T	C	8: 33,742,559	T11A	possibly damaging	Het
Snx6	G	A	12: 54,770,743	T7I	probably damaging	Het
Srcin1	T	A	11: 97,551,942	D75V	probably damaging	Het
Srsf12	T	A	4: 33,231,174	S223T	probably damaging	Het
Taf4b	G	T	18: 14,813,542	C474F	probably damaging	Het
Tango6	T	A	8: 106,718,090	C542*	probably null	Het
Tbc1d24	A	G	17: 24,208,536	S151P	possibly damaging	Het
Tssk6	T	C	8: 69,903,064	S253P	probably benign	Het
Ttc39c	G	A	18: 12,724,942	W300*	probably null	Het
Ttc6	T	A	12: 57,643,140	W539R	probably benign	Het
Ttn	T	C	2: 76,752,426	T22708A	probably damaging	Het
Ttn	C	A	2: 76,918,709	E3999*	probably null	Het
Vill	T	G	9: 119,068,440	L261R	probably damaging	Het
Vmn1r20	T	C	6: 57,432,174	S162P	probably damaging	Het
Zfp516	T	C	18: 82,956,094	I139T	probably benign	Het

Other mutations in Mill2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01861:Mill2	APN	7	18856640	missense	probably damaging	0.98
IGL02465:Mill2	APN	7	18858243	nonsense	probably null
IGL02876:Mill2	APN	7	18856507	missense	probably damaging	1.00
R1725:Mill2	UTSW	7	18840068	missense	probably benign	0.04
R1945:Mill2	UTSW	7	18841494	missense	probably benign	0.00
R1964:Mill2	UTSW	7	18856604	missense	probably damaging	1.00
R2260:Mill2	UTSW	7	18856488	missense	probably benign	0.14
R3160:Mill2	UTSW	7	18856174	missense	probably benign	0.32
R3162:Mill2	UTSW	7	18856174	missense	probably benign	0.32
R4302:Mill2	UTSW	7	18856531	missense	probably damaging	0.98
R5121:Mill2	UTSW	7	18856666	missense	probably benign	0.39
R5365:Mill2	UTSW	7	18858414	missense	probably benign	0.01
R5557:Mill2	UTSW	7	18855959	nonsense	probably null
R5736:Mill2	UTSW	7	18858249	missense	probably benign	0.01
R5998:Mill2	UTSW	7	18840064	missense	probably benign	0.00
R6004:Mill2	UTSW	7	18856538	missense	probably benign	0.32
R6016:Mill2	UTSW	7	18856448	missense	probably benign	0.45
R6045:Mill2	UTSW	7	18856564	missense	probably benign	0.01
R6534:Mill2	UTSW	7	18856596	missense	possibly damaging	0.91
R6913:Mill2	UTSW	7	18856426	missense	probably null	1.00
R7386:Mill2	UTSW	7	18858290	missense	probably benign	0.16
Z1088:Mill2	UTSW	7	18856399	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ATGGGAGCACTAGAGGCTTCTG -3'
(R):5'- CGTTTGAATCTGTAGTCCGGC -3'

Sequencing Primer
(F):5'- ATGATGGGCAGAACTTCCTC -3'
(R):5'- GAATCTGTAGTCCGGCTCCATG -3'

Posted On

2016-04-27