Incidental Mutation 'R4946:Olfr467'
ID383414
Institutional Source Beutler Lab
Gene Symbol Olfr467
Ensembl Gene ENSMUSG00000066242
Gene Nameolfactory receptor 467
SynonymsMOR204-33P, GA_x6K02T2PBJ9-10144091-10145011
MMRRC Submission 042543-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4946 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107812263-107816336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107815382 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 266 (H266R)
Ref Sequence ENSEMBL: ENSMUSP00000149295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084756] [ENSMUST00000208563] [ENSMUST00000214253]
Predicted Effect probably benign
Transcript: ENSMUST00000084756
AA Change: H268R

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000081811
Gene: ENSMUSG00000066242
AA Change: H268R

DomainStartEndE-ValueType
Pfam:7tm_4 33 308 5.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 37 307 8.3e-7 PFAM
Pfam:7tm_1 43 292 2.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207203
Predicted Effect possibly damaging
Transcript: ENSMUST00000208563
AA Change: H266R

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000214253
AA Change: H266R

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Adgre1 G A 17: 57,443,918 V531I probably benign Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank2 A T 3: 126,941,940 probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Krt77 T C 15: 101,869,563 Y19C unknown Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Mtmr6 C T 14: 60,280,189 P83L possibly damaging Het
Myh3 T C 11: 67,093,538 I1067T probably benign Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plcb1 A G 2: 135,345,095 I761V probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Pparg A G 6: 115,451,028 K159E probably damaging Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Zfp516 T C 18: 82,956,094 I139T probably benign Het
Other mutations in Olfr467
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0110:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0450:Olfr467 UTSW 7 107814688 missense probably damaging 1.00
R0707:Olfr467 UTSW 7 107815124 missense probably damaging 0.99
R0918:Olfr467 UTSW 7 107815211 missense probably benign 0.03
R1416:Olfr467 UTSW 7 107815262 missense probably damaging 1.00
R1988:Olfr467 UTSW 7 107814700 missense probably benign
R1989:Olfr467 UTSW 7 107814700 missense probably benign
R2219:Olfr467 UTSW 7 107815222 missense probably benign
R2241:Olfr467 UTSW 7 107814833 missense possibly damaging 0.62
R2866:Olfr467 UTSW 7 107814919 missense probably benign 0.06
R4972:Olfr467 UTSW 7 107814746 missense probably benign 0.10
R5099:Olfr467 UTSW 7 107814602 missense probably benign 0.00
R5310:Olfr467 UTSW 7 107814964 missense probably damaging 1.00
R5323:Olfr467 UTSW 7 107814676 missense possibly damaging 0.96
R5531:Olfr467 UTSW 7 107815244 missense probably benign 0.03
R5672:Olfr467 UTSW 7 107814637 missense probably damaging 1.00
R5758:Olfr467 UTSW 7 107814815 missense probably damaging 0.99
R5891:Olfr467 UTSW 7 107815180 missense probably damaging 1.00
R6016:Olfr467 UTSW 7 107815012 missense probably benign 0.01
R6399:Olfr467 UTSW 7 107814754 missense possibly damaging 0.78
R6466:Olfr467 UTSW 7 107814694 missense probably benign
R6894:Olfr467 UTSW 7 107815064 missense probably benign 0.25
R7543:Olfr467 UTSW 7 107815101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTCCATCATCGTCATCAC -3'
(R):5'- TCCAGACTCTAGTGCAAATGATC -3'

Sequencing Primer
(F):5'- ATCGTCATCACCCTGTTCGTAATC -3'
(R):5'- TTTTCATGCTAACAAGGCAAACAAC -3'
Posted On2016-04-27