Incidental Mutation 'R4946:Myh3'
ID383434
Institutional Source Beutler Lab
Gene Symbol Myh3
Ensembl Gene ENSMUSG00000020908
Gene Namemyosin, heavy polypeptide 3, skeletal muscle, embryonic
SynonymsMyhse, Myhs-e, MyHC-emb
MMRRC Submission 042543-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R4946 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67078300-67102291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67093538 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1067 (I1067T)
Ref Sequence ENSEMBL: ENSMUSP00000131883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007301] [ENSMUST00000108689] [ENSMUST00000165221]
Predicted Effect probably benign
Transcript: ENSMUST00000007301
AA Change: I1067T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007301
Gene: ENSMUSG00000020908
AA Change: I1067T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108689
AA Change: I1067T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104329
Gene: ENSMUSG00000020908
AA Change: I1067T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-14 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
low complexity region 844 856 N/A INTRINSIC
low complexity region 925 939 N/A INTRINSIC
low complexity region 1020 1028 N/A INTRINSIC
Pfam:Myosin_tail_1 1069 1927 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165221
AA Change: I1067T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131883
Gene: ENSMUSG00000020908
AA Change: I1067T

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 2.2e-13 PFAM
MYSc 80 780 N/A SMART
IQ 781 803 1.65e-2 SMART
IQ 807 829 2.25e2 SMART
Pfam:Myosin_tail_1 844 1925 2.1e-164 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. This gene is a member of the MYH family and encodes a protein with an IQ domain and a myosin head-like domain. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Adgre1 G A 17: 57,443,918 V531I probably benign Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank2 A T 3: 126,941,940 probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Krt77 T C 15: 101,869,563 Y19C unknown Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Mtmr6 C T 14: 60,280,189 P83L possibly damaging Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr467 A G 7: 107,815,382 H266R possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plcb1 A G 2: 135,345,095 I761V probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Pparg A G 6: 115,451,028 K159E probably damaging Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Zfp516 T C 18: 82,956,094 I139T probably benign Het
Other mutations in Myh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Myh3 APN 11 67090855 missense probably damaging 1.00
IGL01989:Myh3 APN 11 67086655 missense probably damaging 1.00
IGL02097:Myh3 APN 11 67082924 missense probably benign
IGL02197:Myh3 APN 11 67098583 missense probably benign 0.05
IGL02458:Myh3 APN 11 67096940 missense possibly damaging 0.87
IGL02526:Myh3 APN 11 67087545 missense probably benign 0.01
IGL02559:Myh3 APN 11 67101095 missense possibly damaging 0.94
IGL02600:Myh3 APN 11 67083401 missense probably damaging 1.00
IGL02866:Myh3 APN 11 67089023 missense probably benign 0.08
IGL02943:Myh3 APN 11 67091065 missense probably benign 0.02
IGL03087:Myh3 APN 11 67090972 missense probably damaging 1.00
IGL03131:Myh3 APN 11 67091109 splice site probably benign
R0049:Myh3 UTSW 11 67099672 missense probably damaging 1.00
R0157:Myh3 UTSW 11 67082909 missense probably benign 0.00
R0266:Myh3 UTSW 11 67093672 missense possibly damaging 0.73
R0352:Myh3 UTSW 11 67090428 missense possibly damaging 0.79
R0391:Myh3 UTSW 11 67096507 splice site probably benign
R0926:Myh3 UTSW 11 67090514 splice site probably null
R1243:Myh3 UTSW 11 67090453 missense possibly damaging 0.80
R1344:Myh3 UTSW 11 67092332 missense probably benign 0.03
R1414:Myh3 UTSW 11 67098665 missense probably damaging 0.98
R1442:Myh3 UTSW 11 67087277 missense possibly damaging 0.77
R1470:Myh3 UTSW 11 67098059 splice site probably benign
R1480:Myh3 UTSW 11 67093545 missense possibly damaging 0.88
R1598:Myh3 UTSW 11 67093171 missense probably damaging 1.00
R1620:Myh3 UTSW 11 67088736 splice site probably benign
R1682:Myh3 UTSW 11 67089065 missense probably damaging 1.00
R1759:Myh3 UTSW 11 67096891 missense probably damaging 0.98
R1772:Myh3 UTSW 11 67099394 missense probably benign 0.32
R1868:Myh3 UTSW 11 67085026 missense probably benign 0.34
R1874:Myh3 UTSW 11 67093179 missense probably benign 0.03
R1885:Myh3 UTSW 11 67086627 missense probably benign 0.23
R1923:Myh3 UTSW 11 67080002 missense probably benign 0.00
R2145:Myh3 UTSW 11 67091056 missense probably benign
R3973:Myh3 UTSW 11 67096436 nonsense probably null
R4410:Myh3 UTSW 11 67085032 missense possibly damaging 0.71
R4583:Myh3 UTSW 11 67096453 nonsense probably null
R4650:Myh3 UTSW 11 67086444 missense probably damaging 1.00
R4822:Myh3 UTSW 11 67089010 missense probably benign
R4836:Myh3 UTSW 11 67096939 missense probably benign 0.01
R4898:Myh3 UTSW 11 67099407 missense probably benign 0.05
R5506:Myh3 UTSW 11 67084089 missense probably damaging 1.00
R5534:Myh3 UTSW 11 67097044 missense probably damaging 1.00
R5733:Myh3 UTSW 11 67088619 missense probably benign 0.24
R5889:Myh3 UTSW 11 67086375 missense probably damaging 1.00
R6056:Myh3 UTSW 11 67087545 missense probably benign 0.01
R6223:Myh3 UTSW 11 67098017 missense probably benign
R6228:Myh3 UTSW 11 67087486 missense probably benign 0.17
R6341:Myh3 UTSW 11 67082996 missense probably benign 0.00
R6434:Myh3 UTSW 11 67082367 missense probably damaging 1.00
R6533:Myh3 UTSW 11 67090419 missense probably damaging 0.96
R6812:Myh3 UTSW 11 67086402 missense probably damaging 0.99
R7336:Myh3 UTSW 11 67091021 missense probably benign 0.13
R7354:Myh3 UTSW 11 67096882 missense probably damaging 1.00
R7498:Myh3 UTSW 11 67097048 missense possibly damaging 0.96
R7532:Myh3 UTSW 11 67091095 missense probably benign
R7841:Myh3 UTSW 11 67098692 missense probably damaging 1.00
R7878:Myh3 UTSW 11 67087251 missense probably damaging 1.00
R8169:Myh3 UTSW 11 67089030 missense probably benign 0.06
R8194:Myh3 UTSW 11 67092002 missense probably damaging 1.00
R8215:Myh3 UTSW 11 67101179 missense probably damaging 0.99
R8240:Myh3 UTSW 11 67092370 missense probably benign 0.01
R8255:Myh3 UTSW 11 67095022 missense probably damaging 1.00
R8310:Myh3 UTSW 11 67096007 critical splice acceptor site probably null
RF009:Myh3 UTSW 11 67086355 frame shift probably null
RF009:Myh3 UTSW 11 67086356 frame shift probably null
RF009:Myh3 UTSW 11 67086357 frame shift probably null
RF010:Myh3 UTSW 11 67086356 frame shift probably null
RF010:Myh3 UTSW 11 67086359 frame shift probably null
RF013:Myh3 UTSW 11 67086356 frame shift probably null
RF015:Myh3 UTSW 11 67086356 frame shift probably null
X0060:Myh3 UTSW 11 67094998 missense probably benign 0.00
X0062:Myh3 UTSW 11 67089116 missense probably benign 0.03
Z1176:Myh3 UTSW 11 67082415 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGCATCAGTCTCAGGAGTCTTAAG -3'
(R):5'- AGGCTCAAGGTCTGCTCATC -3'

Sequencing Primer
(F):5'- CAGTCTCAGGAGTCTTAAGGCTTCAG -3'
(R):5'- AAGGTCTGCTCATCTTCCAC -3'
Posted On2016-04-27