Incidental Mutation 'R0333:Olfr23'
ID38345
Institutional Source Beutler Lab
Gene Symbol Olfr23
Ensembl Gene ENSMUSG00000069816
Gene Nameolfactory receptor 23
SynonymsMTPCR50, MOR135-27, GA_x6K02T2P1NL-4097159-4098136
MMRRC Submission 038542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R0333 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73936677-73942658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73940767 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 174 (I174F)
Ref Sequence ENSEMBL: ENSMUSP00000150593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092917] [ENSMUST00000214210]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092917
AA Change: I174F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090596
Gene: ENSMUSG00000069816
AA Change: I174F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.8e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 3.8e-6 PFAM
Pfam:7tm_1 41 290 9.3e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214210
AA Change: I174F

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
Meta Mutation Damage Score 0.1355 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 T C 9: 106,241,281 N214S probably benign Het
Antxr1 A G 6: 87,188,838 probably benign Het
Atxn7l3 A T 11: 102,294,992 probably null Het
Cab39l A G 14: 59,499,611 E60G probably damaging Het
Cdc5l G T 17: 45,393,216 probably benign Het
Cux2 T C 5: 121,860,608 E1423G probably benign Het
Dbndd1 G T 8: 123,506,773 Q165K probably damaging Het
Drd1 C A 13: 54,054,063 C37F probably damaging Het
Elp3 G A 14: 65,590,593 P11L probably benign Het
F830045P16Rik A G 2: 129,472,857 Y167H probably damaging Het
Gimap3 G A 6: 48,765,730 Q89* probably null Het
Herc1 G A 9: 66,464,699 probably null Het
Hist3h2a C A 11: 58,954,859 S41* probably null Het
Ipo11 A G 13: 106,870,763 V603A probably benign Het
Kifap3 G A 1: 163,797,264 A130T probably damaging Het
Klhl23 A G 2: 69,833,897 Y530C probably damaging Het
Map4k1 C T 7: 28,999,761 probably benign Het
Mroh2b T A 15: 4,931,118 L778M probably damaging Het
Mtdh T C 15: 34,118,101 S344P possibly damaging Het
Ncoa3 T G 2: 166,054,291 N371K probably damaging Het
Ncor2 C A 5: 125,034,344 probably benign Het
Nrn1l A G 8: 105,894,420 E48G probably benign Het
Nudcd1 A G 15: 44,401,287 I271T probably benign Het
Olfr31 T C 14: 14,328,498 L129P probably damaging Het
Pard3b A G 1: 62,230,212 N653S probably benign Het
Park2 T C 17: 11,067,140 F6L probably damaging Het
Plekhg1 A C 10: 3,964,419 K1380N probably damaging Het
Ppara T A 15: 85,790,960 I210N probably damaging Het
Ppp2r5b A G 19: 6,229,047 probably benign Het
Prr14l A G 5: 32,827,993 L1386P probably damaging Het
Ralgapa1 A G 12: 55,782,900 probably benign Het
Reln A T 5: 21,929,242 L2563I probably damaging Het
Rps7 A G 12: 28,631,201 probably benign Het
Rslcan18 T C 13: 67,098,622 K309E probably damaging Het
Sec14l5 C T 16: 5,167,066 T92M probably damaging Het
Slc22a8 G A 19: 8,608,150 probably benign Het
Smad2 G A 18: 76,262,621 A44T probably damaging Het
Smcr8 T C 11: 60,780,222 V732A possibly damaging Het
Spata2l A G 8: 123,233,632 F306S probably damaging Het
Stab2 T C 10: 86,841,627 D2552G probably benign Het
Tctn3 A T 19: 40,607,267 L358H possibly damaging Het
Tk2 C T 8: 104,248,514 probably benign Het
Tm6sf2 C T 8: 70,077,914 R215C probably damaging Het
Tmbim6 T C 15: 99,406,674 I204T probably damaging Het
Tubgcp2 C A 7: 139,999,347 W675C probably damaging Het
Usp48 T A 4: 137,594,483 I62N probably damaging Het
Vmn2r74 T C 7: 85,952,283 T716A probably benign Het
Vps13b C A 15: 35,879,803 T3008K probably damaging Het
Wnk1 G A 6: 119,928,163 probably benign Het
Other mutations in Olfr23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Olfr23 APN 11 73941194 missense probably benign
IGL02290:Olfr23 APN 11 73940869 missense probably benign 0.00
IGL02301:Olfr23 APN 11 73941068 missense possibly damaging 0.79
IGL02303:Olfr23 APN 11 73940450 missense possibly damaging 0.87
IGL02510:Olfr23 APN 11 73941005 missense probably damaging 1.00
IGL02558:Olfr23 APN 11 73940825 missense probably benign 0.01
IGL02712:Olfr23 APN 11 73940930 missense probably benign 0.12
IGL02795:Olfr23 APN 11 73940929 missense probably benign 0.05
IGL02800:Olfr23 APN 11 73941116 missense probably damaging 1.00
IGL03350:Olfr23 APN 11 73940838 missense probably damaging 0.99
R0277:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0323:Olfr23 UTSW 11 73940947 missense probably benign 0.28
R0389:Olfr23 UTSW 11 73941053 missense probably benign 0.12
R0391:Olfr23 UTSW 11 73941109 missense probably damaging 1.00
R0723:Olfr23 UTSW 11 73940270 missense probably benign 0.00
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1469:Olfr23 UTSW 11 73940557 missense probably benign 0.05
R1900:Olfr23 UTSW 11 73940660 missense possibly damaging 0.79
R2363:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4236:Olfr23 UTSW 11 73940356 missense possibly damaging 0.96
R4630:Olfr23 UTSW 11 73940996 missense probably damaging 1.00
R4717:Olfr23 UTSW 11 73940815 missense possibly damaging 0.86
R4801:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4802:Olfr23 UTSW 11 73940870 missense possibly damaging 0.88
R4964:Olfr23 UTSW 11 73941202 missense probably benign 0.04
R5119:Olfr23 UTSW 11 73940552 missense possibly damaging 0.76
R5470:Olfr23 UTSW 11 73940870 missense probably benign 0.06
R6196:Olfr23 UTSW 11 73940809 missense possibly damaging 0.86
R6551:Olfr23 UTSW 11 73940303 missense probably benign 0.11
R7695:Olfr23 UTSW 11 73940894 missense possibly damaging 0.94
R8074:Olfr23 UTSW 11 73940387 missense possibly damaging 0.78
X0065:Olfr23 UTSW 11 73940324 missense possibly damaging 0.59
Z1088:Olfr23 UTSW 11 73941138 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATTTCCTGCAAAACATGCAGAGCC -3'
(R):5'- AGTGGAGAAGACCTTGTGGATGCC -3'

Sequencing Primer
(F):5'- AGGCTGCCTTGCACAAATG -3'
(R):5'- AGGAGACAATGTGCGCAT -3'
Posted On2013-05-23