Incidental Mutation 'R4946:Krt77'
ID383455
Institutional Source Beutler Lab
Gene Symbol Krt77
Ensembl Gene ENSMUSG00000067594
Gene Namekeratin 77
Synonyms4732484G22Rik
MMRRC Submission 042543-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4946 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location101858731-101869705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101869563 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 19 (Y19C)
Ref Sequence ENSEMBL: ENSMUSP00000085311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087996]
Predicted Effect unknown
Transcript: ENSMUST00000087996
AA Change: Y19C
SMART Domains Protein: ENSMUSP00000085311
Gene: ENSMUSG00000067594
AA Change: Y19C

DomainStartEndE-ValueType
Pfam:Keratin_2_head 4 163 1.5e-46 PFAM
Filament 166 479 6.11e-149 SMART
low complexity region 485 497 N/A INTRINSIC
low complexity region 500 543 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229995
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in the skin and eccrine sweat glands. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Adgre1 G A 17: 57,443,918 V531I probably benign Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank2 A T 3: 126,941,940 probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Mtmr6 C T 14: 60,280,189 P83L possibly damaging Het
Myh3 T C 11: 67,093,538 I1067T probably benign Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr467 A G 7: 107,815,382 H266R possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plcb1 A G 2: 135,345,095 I761V probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Pparg A G 6: 115,451,028 K159E probably damaging Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Zfp516 T C 18: 82,956,094 I139T probably benign Het
Other mutations in Krt77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Krt77 APN 15 101860880 splice site probably benign
IGL01912:Krt77 APN 15 101863851 splice site probably benign
IGL02505:Krt77 APN 15 101860946 missense probably damaging 1.00
IGL02875:Krt77 APN 15 101869149 missense probably damaging 1.00
R0266:Krt77 UTSW 15 101869378 missense possibly damaging 0.71
R0347:Krt77 UTSW 15 101859869 missense unknown
R0762:Krt77 UTSW 15 101861126 intron probably null
R1528:Krt77 UTSW 15 101861088 missense probably damaging 1.00
R1556:Krt77 UTSW 15 101861278 missense probably damaging 0.96
R1973:Krt77 UTSW 15 101861244 missense probably damaging 1.00
R4434:Krt77 UTSW 15 101865469 missense probably damaging 1.00
R4436:Krt77 UTSW 15 101865469 missense probably damaging 1.00
R5405:Krt77 UTSW 15 101861088 missense probably damaging 0.96
R5507:Krt77 UTSW 15 101861230 missense probably benign 0.03
R5888:Krt77 UTSW 15 101865453 missense probably benign 0.29
R5978:Krt77 UTSW 15 101862928 missense probably benign 0.07
R5994:Krt77 UTSW 15 101862855 missense probably damaging 1.00
R6039:Krt77 UTSW 15 101860916 missense possibly damaging 0.85
R6039:Krt77 UTSW 15 101860916 missense possibly damaging 0.85
R6241:Krt77 UTSW 15 101865553 missense probably damaging 1.00
R6260:Krt77 UTSW 15 101864372 nonsense probably null
R6280:Krt77 UTSW 15 101865475 missense probably damaging 1.00
R6500:Krt77 UTSW 15 101864337 missense probably damaging 0.99
R6563:Krt77 UTSW 15 101862923 missense probably damaging 1.00
R7153:Krt77 UTSW 15 101865496 missense probably benign 0.18
R7156:Krt77 UTSW 15 101865496 missense probably benign 0.18
R7205:Krt77 UTSW 15 101869371 missense probably benign 0.00
R7379:Krt77 UTSW 15 101861274 missense probably damaging 1.00
R7407:Krt77 UTSW 15 101860095 missense unknown
Predicted Primers PCR Primer
(F):5'- GAAACCACTGGCACTTCGTC -3'
(R):5'- ACTGGCAGGCAAATACTCCC -3'

Sequencing Primer
(F):5'- GTCCCACTAGGTTCCCAAAGATG -3'
(R):5'- CTCCCAGGGTTCGGAAAGTTTC -3'
Posted On2016-04-27