Mutagenetix > Incidental Mutation

Incidental Mutation 'R4946:Dsc2'

383463

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

042543-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4946 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20050157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 68 (D68G)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: D68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: D68G

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: D68G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: D68G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000128464
AA Change: D68G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331
AA Change: D68G

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 99.0%
3x: 98.2%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca8a	T	C	11: 110,086,474	D98G	probably damaging	Het
Adgre1	G	A	17: 57,443,918	V531I	probably benign	Het
Aldoart2	A	G	12: 55,566,016	Q242R	probably benign	Het
Ank2	A	T	3: 126,941,940		probably benign	Het
Ank3	C	T	10: 69,898,117	A737V	probably damaging	Het
Ankle2	A	G	5: 110,253,838	I789V	probably benign	Het
Ankrd13c	T	C	3: 158,005,773	V510A	probably damaging	Het
Arid1b	T	A	17: 5,342,843	M2216K	probably damaging	Het
Arrdc1	A	G	2: 24,925,848	V380A	probably benign	Het
B3galt1	C	A	2: 68,118,569	N209K	possibly damaging	Het
Cd300c2	A	T	11: 114,996,905	C224S	probably benign	Het
Cdk4	T	C	10: 127,064,890		probably null	Het
Cdk5rap1	T	C	2: 154,368,874	T115A	possibly damaging	Het
Clvs1	A	T	4: 9,281,831	R92*	probably null	Het
Cnga1	A	G	5: 72,604,764	V469A	probably damaging	Het
Ctns	A	G	11: 73,196,653	F16L	probably benign	Het
Dlg5	A	T	14: 24,154,361	C1299S	probably damaging	Het
Dnah3	T	A	7: 119,931,560	Y3690F	probably damaging	Het
Dnah5	A	G	15: 28,326,557	M1971V	probably damaging	Het
Dnah5	G	A	15: 28,387,904	V3170M	probably damaging	Het
Dpp8	T	C	9: 65,055,918	Y485H	probably benign	Het
Elavl1	A	T	8: 4,301,752	D121E	probably benign	Het
Ermap	A	G	4: 119,183,308	V311A	probably damaging	Het
Fam102b	A	G	3: 108,980,228	V240A	probably benign	Het
Fbxw11	C	T	11: 32,739,226	R437C	probably damaging	Het
Gas2l3	T	C	10: 89,413,772	M495V	probably benign	Het
Hacd1	C	T	2: 14,045,137		probably null	Het
Itgav	A	G	2: 83,788,983	R596G	probably benign	Het
Kars	T	C	8: 112,001,720	H215R	possibly damaging	Het
Kif26a	G	A	12: 112,177,794	R1494H	probably damaging	Het
Klf12	G	A	14: 100,022,957	S112L	possibly damaging	Het
Krt77	T	C	15: 101,869,563	Y19C	unknown	Het
Lrrc4c	A	G	2: 97,630,489	T487A	probably benign	Het
Lrrn1	A	G	6: 107,568,890	M550V	probably benign	Het
Lsr	C	A	7: 30,958,209	R442L	probably benign	Het
Lysmd2	A	C	9: 75,635,446	T112P	probably damaging	Het
Mctp2	A	T	7: 72,259,269	S99T	probably benign	Het
Mettl4	A	G	17: 94,740,532	V227A	probably benign	Het
Mill2	T	A	7: 18,856,683		probably null	Het
Mpp3	T	C	11: 102,005,022	N476D	probably benign	Het
Mtmr6	C	T	14: 60,280,189	P83L	possibly damaging	Het
Myh3	T	C	11: 67,093,538	I1067T	probably benign	Het
Myh9	C	A	15: 77,773,340	Q1068H	probably damaging	Het
Narf	T	A	11: 121,250,353	H304Q	possibly damaging	Het
Nfatc2ip	G	T	7: 126,396,612	P35Q	possibly damaging	Het
Npas3	C	A	12: 54,065,835	P426Q	probably damaging	Het
Olfr1289	T	C	2: 111,483,966	Y207H	possibly damaging	Het
Olfr1508	G	A	14: 52,463,283	T242I	probably damaging	Het
Olfr432	T	G	1: 174,050,834	S154A	possibly damaging	Het
Olfr467	A	G	7: 107,815,382	H266R	possibly damaging	Het
Olfr640	T	A	7: 104,022,012	Q102L	probably damaging	Het
Pcdh10	A	T	3: 45,379,482	E77V	probably damaging	Het
Pcnt	C	T	10: 76,356,185	R2764Q	probably damaging	Het
Pgbd5	T	C	8: 124,370,585	D493G	possibly damaging	Het
Piezo2	G	T	18: 63,157,262	T142N	probably benign	Het
Plcb1	A	G	2: 135,345,095	I761V	probably benign	Het
Plekhg4	T	G	8: 105,381,996	D1196E	probably null	Het
Pparg	A	G	6: 115,451,028	K159E	probably damaging	Het
Psmb1	A	T	17: 15,498,216	M16K	probably benign	Het
Ptprq	T	C	10: 107,525,734	I2139V	probably benign	Het
Ralgapb	T	A	2: 158,440,967	S239T	probably damaging	Het
Serpina11	A	G	12: 103,984,664	V266A	probably damaging	Het
Sf3a2	C	G	10: 80,804,113		probably benign	Het
Smim18	T	C	8: 33,742,559	T11A	possibly damaging	Het
Snx6	G	A	12: 54,770,743	T7I	probably damaging	Het
Srcin1	T	A	11: 97,551,942	D75V	probably damaging	Het
Srsf12	T	A	4: 33,231,174	S223T	probably damaging	Het
Taf4b	G	T	18: 14,813,542	C474F	probably damaging	Het
Tango6	T	A	8: 106,718,090	C542*	probably null	Het
Tbc1d24	A	G	17: 24,208,536	S151P	possibly damaging	Het
Tssk6	T	C	8: 69,903,064	S253P	probably benign	Het
Ttc39c	G	A	18: 12,724,942	W300*	probably null	Het
Ttc6	T	A	12: 57,643,140	W539R	probably benign	Het
Ttn	T	C	2: 76,752,426	T22708A	probably damaging	Het
Ttn	C	A	2: 76,918,709	E3999*	probably null	Het
Vill	T	G	9: 119,068,440	L261R	probably damaging	Het
Vmn1r20	T	C	6: 57,432,174	S162P	probably damaging	Het
Zfp516	T	C	18: 82,956,094	I139T	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCAGTTAGCCCTAAAGAAACAC -3'
(R):5'- TCACATGCCTTTATTTCAGGACAC -3'

Sequencing Primer
(F):5'- AATTACACTCCATGCATATCATCTC -3'
(R):5'- CATGCCTTTATTTCAGGACACATATC -3'

Posted On

2016-04-27