Incidental Mutation 'R4946:Zfp516'
ID383465
Institutional Source Beutler Lab
Gene Symbol Zfp516
Ensembl Gene ENSMUSG00000058881
Gene Namezinc finger protein 516
SynonymsC330029B10Rik, Zfp26l
MMRRC Submission 042543-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R4946 (G1)
Quality Score146
Status Not validated
Chromosome18
Chromosomal Location82910879-83005314 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82956094 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 139 (I139T)
Ref Sequence ENSEMBL: ENSMUSP00000126629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071233] [ENSMUST00000171238]
Predicted Effect probably benign
Transcript: ENSMUST00000071233
AA Change: I139T

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071216
Gene: ENSMUSG00000058881
AA Change: I139T

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171238
AA Change: I139T

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126629
Gene: ENSMUSG00000058881
AA Change: I139T

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
ZnF_C2H2 34 56 1.03e-2 SMART
ZnF_C2H2 62 84 3.95e-4 SMART
ZnF_C2H2 162 185 8.09e-1 SMART
ZnF_C2H2 188 211 1.76e-1 SMART
ZnF_C2H2 236 258 3.16e-3 SMART
ZnF_C2H2 264 286 3.34e-2 SMART
ZnF_C2H2 323 345 2.63e0 SMART
ZnF_C2H2 504 526 5.72e-1 SMART
low complexity region 527 544 N/A INTRINSIC
ZnF_C2H2 753 776 2.97e1 SMART
low complexity region 834 846 N/A INTRINSIC
ZnF_C2H2 1092 1114 1.12e-3 SMART
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc-finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,086,474 D98G probably damaging Het
Adgre1 G A 17: 57,443,918 V531I probably benign Het
Aldoart2 A G 12: 55,566,016 Q242R probably benign Het
Ank2 A T 3: 126,941,940 probably benign Het
Ank3 C T 10: 69,898,117 A737V probably damaging Het
Ankle2 A G 5: 110,253,838 I789V probably benign Het
Ankrd13c T C 3: 158,005,773 V510A probably damaging Het
Arid1b T A 17: 5,342,843 M2216K probably damaging Het
Arrdc1 A G 2: 24,925,848 V380A probably benign Het
B3galt1 C A 2: 68,118,569 N209K possibly damaging Het
Cd300c2 A T 11: 114,996,905 C224S probably benign Het
Cdk4 T C 10: 127,064,890 probably null Het
Cdk5rap1 T C 2: 154,368,874 T115A possibly damaging Het
Clvs1 A T 4: 9,281,831 R92* probably null Het
Cnga1 A G 5: 72,604,764 V469A probably damaging Het
Ctns A G 11: 73,196,653 F16L probably benign Het
Dlg5 A T 14: 24,154,361 C1299S probably damaging Het
Dnah3 T A 7: 119,931,560 Y3690F probably damaging Het
Dnah5 A G 15: 28,326,557 M1971V probably damaging Het
Dnah5 G A 15: 28,387,904 V3170M probably damaging Het
Dpp8 T C 9: 65,055,918 Y485H probably benign Het
Dsc2 T C 18: 20,050,157 D68G probably damaging Het
Elavl1 A T 8: 4,301,752 D121E probably benign Het
Ermap A G 4: 119,183,308 V311A probably damaging Het
Fam102b A G 3: 108,980,228 V240A probably benign Het
Fbxw11 C T 11: 32,739,226 R437C probably damaging Het
Gas2l3 T C 10: 89,413,772 M495V probably benign Het
Hacd1 C T 2: 14,045,137 probably null Het
Itgav A G 2: 83,788,983 R596G probably benign Het
Kars T C 8: 112,001,720 H215R possibly damaging Het
Kif26a G A 12: 112,177,794 R1494H probably damaging Het
Klf12 G A 14: 100,022,957 S112L possibly damaging Het
Krt77 T C 15: 101,869,563 Y19C unknown Het
Lrrc4c A G 2: 97,630,489 T487A probably benign Het
Lrrn1 A G 6: 107,568,890 M550V probably benign Het
Lsr C A 7: 30,958,209 R442L probably benign Het
Lysmd2 A C 9: 75,635,446 T112P probably damaging Het
Mctp2 A T 7: 72,259,269 S99T probably benign Het
Mettl4 A G 17: 94,740,532 V227A probably benign Het
Mill2 T A 7: 18,856,683 probably null Het
Mpp3 T C 11: 102,005,022 N476D probably benign Het
Mtmr6 C T 14: 60,280,189 P83L possibly damaging Het
Myh3 T C 11: 67,093,538 I1067T probably benign Het
Myh9 C A 15: 77,773,340 Q1068H probably damaging Het
Narf T A 11: 121,250,353 H304Q possibly damaging Het
Nfatc2ip G T 7: 126,396,612 P35Q possibly damaging Het
Npas3 C A 12: 54,065,835 P426Q probably damaging Het
Olfr1289 T C 2: 111,483,966 Y207H possibly damaging Het
Olfr1508 G A 14: 52,463,283 T242I probably damaging Het
Olfr432 T G 1: 174,050,834 S154A possibly damaging Het
Olfr467 A G 7: 107,815,382 H266R possibly damaging Het
Olfr640 T A 7: 104,022,012 Q102L probably damaging Het
Pcdh10 A T 3: 45,379,482 E77V probably damaging Het
Pcnt C T 10: 76,356,185 R2764Q probably damaging Het
Pgbd5 T C 8: 124,370,585 D493G possibly damaging Het
Piezo2 G T 18: 63,157,262 T142N probably benign Het
Plcb1 A G 2: 135,345,095 I761V probably benign Het
Plekhg4 T G 8: 105,381,996 D1196E probably null Het
Pparg A G 6: 115,451,028 K159E probably damaging Het
Psmb1 A T 17: 15,498,216 M16K probably benign Het
Ptprq T C 10: 107,525,734 I2139V probably benign Het
Ralgapb T A 2: 158,440,967 S239T probably damaging Het
Serpina11 A G 12: 103,984,664 V266A probably damaging Het
Sf3a2 C G 10: 80,804,113 probably benign Het
Smim18 T C 8: 33,742,559 T11A possibly damaging Het
Snx6 G A 12: 54,770,743 T7I probably damaging Het
Srcin1 T A 11: 97,551,942 D75V probably damaging Het
Srsf12 T A 4: 33,231,174 S223T probably damaging Het
Taf4b G T 18: 14,813,542 C474F probably damaging Het
Tango6 T A 8: 106,718,090 C542* probably null Het
Tbc1d24 A G 17: 24,208,536 S151P possibly damaging Het
Tssk6 T C 8: 69,903,064 S253P probably benign Het
Ttc39c G A 18: 12,724,942 W300* probably null Het
Ttc6 T A 12: 57,643,140 W539R probably benign Het
Ttn T C 2: 76,752,426 T22708A probably damaging Het
Ttn C A 2: 76,918,709 E3999* probably null Het
Vill T G 9: 119,068,440 L261R probably damaging Het
Vmn1r20 T C 6: 57,432,174 S162P probably damaging Het
Other mutations in Zfp516
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Zfp516 APN 18 82957108 missense probably benign 0.08
IGL01343:Zfp516 APN 18 82993096 missense probably damaging 0.99
IGL01413:Zfp516 APN 18 82987670 nonsense probably null
IGL01684:Zfp516 APN 18 82957201 missense probably damaging 1.00
IGL01820:Zfp516 APN 18 82987361 missense probably benign 0.00
IGL02081:Zfp516 APN 18 82955733 missense probably benign 0.00
IGL02209:Zfp516 APN 18 82994497 missense probably benign
IGL02253:Zfp516 APN 18 82994497 missense probably benign
IGL03028:Zfp516 APN 18 82955913 missense possibly damaging 0.95
IGL03241:Zfp516 APN 18 82987520 missense probably benign 0.01
R0379:Zfp516 UTSW 18 82987670 nonsense probably null
R0426:Zfp516 UTSW 18 82955772 missense probably benign 0.04
R0466:Zfp516 UTSW 18 82957454 splice site probably null
R0715:Zfp516 UTSW 18 82987263 missense probably damaging 1.00
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R1574:Zfp516 UTSW 18 82993175 missense possibly damaging 0.93
R2110:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2112:Zfp516 UTSW 18 82957411 missense probably damaging 0.99
R2162:Zfp516 UTSW 18 82986938 missense possibly damaging 0.95
R2223:Zfp516 UTSW 18 82955770 missense possibly damaging 0.94
R4097:Zfp516 UTSW 18 82987256 missense possibly damaging 0.95
R4299:Zfp516 UTSW 18 82987497 missense possibly damaging 0.80
R4378:Zfp516 UTSW 18 82987180 missense probably benign 0.00
R4601:Zfp516 UTSW 18 82956039 missense probably benign 0.14
R4721:Zfp516 UTSW 18 82957111 missense possibly damaging 0.49
R5186:Zfp516 UTSW 18 82957093 missense probably benign
R5351:Zfp516 UTSW 18 82956751 missense probably benign 0.00
R5937:Zfp516 UTSW 18 82956833 missense probably damaging 0.99
R5998:Zfp516 UTSW 18 82956514 missense probably damaging 1.00
R6458:Zfp516 UTSW 18 82987350 missense probably benign 0.03
R6513:Zfp516 UTSW 18 82955710 missense probably damaging 1.00
R6626:Zfp516 UTSW 18 82988107 missense probably damaging 1.00
R6712:Zfp516 UTSW 18 82957308 missense probably damaging 1.00
R6877:Zfp516 UTSW 18 82955791 missense probably damaging 1.00
R6886:Zfp516 UTSW 18 82957000 missense probably benign 0.06
R7073:Zfp516 UTSW 18 82988200 critical splice donor site probably null
R7463:Zfp516 UTSW 18 82957108 missense probably benign 0.08
R7863:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R7946:Zfp516 UTSW 18 83001328 missense probably benign 0.00
R8097:Zfp516 UTSW 18 82987170 nonsense probably null
X0019:Zfp516 UTSW 18 82987488 missense probably damaging 1.00
X0065:Zfp516 UTSW 18 82987169 missense probably damaging 1.00
Z1176:Zfp516 UTSW 18 82987533 missense probably benign 0.01
Z1177:Zfp516 UTSW 18 82956066 missense probably damaging 1.00
Z1177:Zfp516 UTSW 18 82956067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCAAGATTCATATCCGCAG -3'
(R):5'- CTCTCTATGTGGCTGAGCAGAG -3'

Sequencing Primer
(F):5'- TTCATATCCGCAGCCACCGG -3'
(R):5'- TATGTGGCTGAGCAGAGACTCC -3'
Posted On2016-04-27