Incidental Mutation 'R4947:D630003M21Rik'
ID383478
Institutional Source Beutler Lab
Gene Symbol D630003M21Rik
Ensembl Gene ENSMUSG00000037813
Gene NameRIKEN cDNA D630003M21 gene
Synonyms
MMRRC Submission 042544-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4947 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location158182533-158229222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158186196 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1095 (T1095S)
Ref Sequence ENSEMBL: ENSMUSP00000130623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103121] [ENSMUST00000169335]
Predicted Effect unknown
Transcript: ENSMUST00000103121
AA Change: T1095S
SMART Domains Protein: ENSMUSP00000099410
Gene: ENSMUSG00000037813
AA Change: T1095S

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000169335
AA Change: T1095S
SMART Domains Protein: ENSMUSP00000130623
Gene: ENSMUSG00000037813
AA Change: T1095S

DomainStartEndE-ValueType
low complexity region 321 333 N/A INTRINSIC
low complexity region 422 435 N/A INTRINSIC
low complexity region 517 535 N/A INTRINSIC
Blast:SEC14 567 702 7e-7 BLAST
SCOP:d1aua_2 567 711 4e-9 SMART
Blast:SPEC 712 824 3e-16 BLAST
low complexity region 826 839 N/A INTRINSIC
low complexity region 903 911 N/A INTRINSIC
low complexity region 918 929 N/A INTRINSIC
low complexity region 1095 1106 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.4%
Validation Efficiency 100% (88/88)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,357,614 H119L probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamtsl1 A T 4: 85,764,800 Q36L possibly damaging Het
Als2cr12 T A 1: 58,676,539 T173S probably benign Het
BC117090 T C 16: 36,321,765 Y83C probably damaging Het
Bcl2a1a G A 9: 88,957,282 E78K probably damaging Het
C130026I21Rik G A 1: 85,112,482 A124V probably damaging Het
Cdk5rap2 A G 4: 70,228,592 probably null Het
Copg1 C A 6: 87,903,473 probably benign Het
Crb2 C T 2: 37,795,331 probably benign Het
Ctbp2 C A 7: 132,999,283 G584C probably damaging Het
Cyp11b2 T C 15: 74,851,570 N415S possibly damaging Het
D630045J12Rik C T 6: 38,148,543 R1512H probably damaging Het
Dnah5 T A 15: 28,272,372 V1078E probably benign Het
Donson A T 16: 91,682,551 D366E probably damaging Het
Evpl T C 11: 116,223,375 E1163G possibly damaging Het
Fcgbp A G 7: 28,089,812 K601R probably benign Het
Fez1 A C 9: 36,868,875 I323L probably damaging Het
Fmnl2 T G 2: 53,073,710 S285A probably benign Het
Frem1 A G 4: 82,966,134 S1194P probably damaging Het
Gm10754 A T 10: 97,682,148 probably benign Het
Gm14226 A T 2: 155,024,959 T279S probably benign Het
Gm16332 G A 1: 139,865,992 noncoding transcript Het
Gm21718 T A 14: 51,315,959 noncoding transcript Het
Gm9866 A T 12: 27,160,228 noncoding transcript Het
Gm9871 A G 6: 101,796,773 noncoding transcript Het
Grm1 A G 10: 10,782,633 F371S probably damaging Het
Gtdc1 T C 2: 44,591,956 I128V probably null Het
H2-Q3 T A 17: 35,359,732 noncoding transcript Het
Ibtk T C 9: 85,710,412 T998A probably benign Het
Ifi204 A G 1: 173,755,750 S301P probably damaging Het
Kcnn1 C A 8: 70,844,429 A545S probably benign Het
Keap1 T G 9: 21,237,553 S53R probably benign Het
Lat A G 7: 126,367,938 V138A probably benign Het
Lrpprc A T 17: 84,771,538 N249K probably benign Het
Lrrc40 A G 3: 158,063,835 I557V probably benign Het
Maml3 A G 3: 51,856,539 F335L probably benign Het
Mcmbp A T 7: 128,712,696 D265E probably damaging Het
Me3 A G 7: 89,633,014 H35R probably benign Het
Mif4gd C A 11: 115,609,637 V32L probably benign Het
Mlana T C 19: 29,700,151 S18P probably damaging Het
Mpnd T A 17: 56,010,268 probably benign Het
Ms4a4b T C 19: 11,454,737 V74A probably benign Het
Mta2 T C 19: 8,946,291 F133L possibly damaging Het
Myo5a A G 9: 75,123,048 M150V probably damaging Het
Nbr1 T C 11: 101,575,077 V487A probably benign Het
Nos3 G A 5: 24,377,855 C660Y probably damaging Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Olfr109 T C 17: 37,466,743 V179A probably damaging Het
Olfr186 A G 16: 59,027,445 L154P probably damaging Het
Olfr376 C T 11: 73,375,417 R223* probably null Het
Olfr669 A G 7: 104,938,742 D72G possibly damaging Het
Pcdh7 A G 5: 57,721,916 K938E probably damaging Het
Pcgf3 T C 5: 108,487,961 F166L probably benign Het
Pid1 A T 1: 84,038,260 V128E possibly damaging Het
Polr3a A C 14: 24,482,464 D187E probably benign Het
Prokr2 T C 2: 132,373,653 D135G probably damaging Het
Rnf141 T C 7: 110,825,320 T14A possibly damaging Het
Serinc1 T C 10: 57,523,045 E254G probably damaging Het
Skint11 T C 4: 114,191,510 F11L possibly damaging Het
Slc22a28 T C 19: 8,131,452 T109A probably benign Het
Sntg1 C A 1: 8,782,798 V43L probably damaging Het
Strn T C 17: 78,661,779 D398G probably damaging Het
Tacc2 A T 7: 130,625,899 E1438V probably damaging Het
Tas2r139 A G 6: 42,141,566 T211A possibly damaging Het
Tbkbp1 T C 11: 97,138,944 probably benign Het
Thbs3 T C 3: 89,226,431 Y897H probably damaging Het
Timm50 G T 7: 28,310,044 probably benign Het
Tmem132a T C 19: 10,866,934 Q100R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Unc93b1 C A 19: 3,935,871 T90K probably benign Het
Upk3bl T C 5: 136,057,245 probably benign Het
Vmn2r112 T A 17: 22,602,879 H179Q probably benign Het
Vmn2r57 A T 7: 41,400,495 F610Y probably damaging Het
Vmn2r80 T G 10: 79,194,698 L786R probably damaging Het
Zc3h14 A G 12: 98,759,824 T323A probably benign Het
Zfp532 T C 18: 65,625,066 I690T possibly damaging Het
Zfp729b T C 13: 67,596,672 N47S probably damaging Het
Other mutations in D630003M21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:D630003M21Rik APN 2 158213412 missense possibly damaging 0.92
IGL01447:D630003M21Rik APN 2 158217356 missense probably benign
IGL01501:D630003M21Rik APN 2 158201067 missense probably benign 0.03
IGL01874:D630003M21Rik APN 2 158204724 missense probably damaging 1.00
IGL02116:D630003M21Rik APN 2 158203210 missense possibly damaging 0.76
IGL02212:D630003M21Rik APN 2 158210171 missense probably benign 0.02
IGL02477:D630003M21Rik APN 2 158217488 missense probably benign 0.44
IGL02644:D630003M21Rik APN 2 158216810 missense possibly damaging 0.87
IGL02861:D630003M21Rik APN 2 158200998 missense probably benign 0.03
IGL02896:D630003M21Rik APN 2 158217285 missense probably benign 0.00
IGL03089:D630003M21Rik APN 2 158216744 missense probably benign
IGL03148:D630003M21Rik APN 2 158217224 missense probably damaging 1.00
ANU05:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
ANU18:D630003M21Rik UTSW 2 158217648 missense probably benign
F5770:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
R0113:D630003M21Rik UTSW 2 158196575 missense possibly damaging 0.92
R0147:D630003M21Rik UTSW 2 158203067 splice site probably benign
R0513:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R0637:D630003M21Rik UTSW 2 158195407 intron probably benign
R1594:D630003M21Rik UTSW 2 158211630 missense probably damaging 1.00
R1774:D630003M21Rik UTSW 2 158220470 missense probably damaging 1.00
R1823:D630003M21Rik UTSW 2 158217557 missense probably damaging 1.00
R1864:D630003M21Rik UTSW 2 158203185 missense probably damaging 1.00
R1983:D630003M21Rik UTSW 2 158208421 missense probably benign 0.34
R2042:D630003M21Rik UTSW 2 158215849 missense probably damaging 1.00
R2259:D630003M21Rik UTSW 2 158204711 missense probably damaging 1.00
R2350:D630003M21Rik UTSW 2 158201011 missense probably damaging 0.96
R3157:D630003M21Rik UTSW 2 158195472 intron probably benign
R3937:D630003M21Rik UTSW 2 158200360 missense probably damaging 1.00
R4124:D630003M21Rik UTSW 2 158196593 missense probably damaging 0.97
R4437:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4473:D630003M21Rik UTSW 2 158213462 missense probably damaging 1.00
R4513:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4514:D630003M21Rik UTSW 2 158204802 missense probably benign 0.01
R4729:D630003M21Rik UTSW 2 158216703 missense probably damaging 1.00
R4794:D630003M21Rik UTSW 2 158196139 missense probably benign
R5005:D630003M21Rik UTSW 2 158211643 missense possibly damaging 0.87
R5022:D630003M21Rik UTSW 2 158217633 missense probably damaging 0.99
R5167:D630003M21Rik UTSW 2 158205745 missense probably damaging 1.00
R5191:D630003M21Rik UTSW 2 158201035 missense probably benign 0.06
R5488:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5489:D630003M21Rik UTSW 2 158217021 missense probably benign 0.15
R5495:D630003M21Rik UTSW 2 158220511 missense possibly damaging 0.69
R5708:D630003M21Rik UTSW 2 158220392 splice site probably null
R5770:D630003M21Rik UTSW 2 158195580 intron probably benign
R5789:D630003M21Rik UTSW 2 158216814 missense possibly damaging 0.63
R5817:D630003M21Rik UTSW 2 158196493 missense probably damaging 1.00
R5898:D630003M21Rik UTSW 2 158204657 splice site probably null
R5969:D630003M21Rik UTSW 2 158217708 missense probably damaging 1.00
R6084:D630003M21Rik UTSW 2 158217584 missense probably damaging 0.99
R6111:D630003M21Rik UTSW 2 158213448 missense probably damaging 1.00
R6225:D630003M21Rik UTSW 2 158217401 missense probably benign 0.23
R6307:D630003M21Rik UTSW 2 158215951 missense probably benign 0.34
R6350:D630003M21Rik UTSW 2 158220495 missense probably damaging 1.00
R6548:D630003M21Rik UTSW 2 158205699 critical splice donor site probably null
R6583:D630003M21Rik UTSW 2 158220516 missense probably damaging 0.98
R6821:D630003M21Rik UTSW 2 158204774 missense probably damaging 1.00
R6963:D630003M21Rik UTSW 2 158200308 missense probably benign 0.44
R7021:D630003M21Rik UTSW 2 158216750 missense possibly damaging 0.59
R7210:D630003M21Rik UTSW 2 158216012 critical splice acceptor site probably null
R7345:D630003M21Rik UTSW 2 158217209 missense probably damaging 1.00
R7355:D630003M21Rik UTSW 2 158200224 missense probably damaging 1.00
R7514:D630003M21Rik UTSW 2 158217353 missense probably damaging 1.00
R7587:D630003M21Rik UTSW 2 158196388 missense probably benign 0.00
R7587:D630003M21Rik UTSW 2 158201056 missense probably damaging 1.00
R7713:D630003M21Rik UTSW 2 158216778 nonsense probably null
V7580:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7581:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
V7583:D630003M21Rik UTSW 2 158201011 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCTGGGGTCTATGACTCTCC -3'
(R):5'- GGGATTGTTTTCTGACTCTAACACATC -3'

Sequencing Primer
(F):5'- ACTCTCCAGTCAGGGGTTC -3'
(R):5'- ACCCATAAAACTGACAGAGTTAATTC -3'
Posted On2016-04-27