Incidental Mutation 'R4947:Adamtsl1'
ID383484
Institutional Source Beutler Lab
Gene Symbol Adamtsl1
Ensembl Gene ENSMUSG00000066113
Gene NameADAMTS-like 1
Synonyms5930437A14Rik, 6720426B09Rik, punctin-1
MMRRC Submission 042544-MU
Accession Numbers

Genbank: NM_172542; MGI: 1924989; Ensembl: ENSMUST00000141889

Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R4947 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location85514172-86428385 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85764800 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 36 (Q36L)
Ref Sequence ENSEMBL: ENSMUSP00000148689 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147066
Predicted Effect possibly damaging
Transcript: ENSMUST00000213098
AA Change: Q36L

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein and member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) family. This protein lacks the metalloproteinase and disintegrin-like domains, which are typical of the ADAMTS family, but contains other ADAMTS domains, including the thrombospondin type 1 motif. This protein may have important functions in the extracellular matrix. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,357,614 H119L probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Als2cr12 T A 1: 58,676,539 T173S probably benign Het
BC117090 T C 16: 36,321,765 Y83C probably damaging Het
Bcl2a1a G A 9: 88,957,282 E78K probably damaging Het
C130026I21Rik G A 1: 85,112,482 A124V probably damaging Het
Cdk5rap2 A G 4: 70,228,592 probably null Het
Copg1 C A 6: 87,903,473 probably benign Het
Crb2 C T 2: 37,795,331 probably benign Het
Ctbp2 C A 7: 132,999,283 G584C probably damaging Het
Cyp11b2 T C 15: 74,851,570 N415S possibly damaging Het
D630003M21Rik T A 2: 158,186,196 T1095S unknown Het
D630045J12Rik C T 6: 38,148,543 R1512H probably damaging Het
Dnah5 T A 15: 28,272,372 V1078E probably benign Het
Donson A T 16: 91,682,551 D366E probably damaging Het
Evpl T C 11: 116,223,375 E1163G possibly damaging Het
Fcgbp A G 7: 28,089,812 K601R probably benign Het
Fez1 A C 9: 36,868,875 I323L probably damaging Het
Fmnl2 T G 2: 53,073,710 S285A probably benign Het
Frem1 A G 4: 82,966,134 S1194P probably damaging Het
Gm10754 A T 10: 97,682,148 probably benign Het
Gm14226 A T 2: 155,024,959 T279S probably benign Het
Gm16332 G A 1: 139,865,992 noncoding transcript Het
Gm21718 T A 14: 51,315,959 noncoding transcript Het
Gm9866 A T 12: 27,160,228 noncoding transcript Het
Gm9871 A G 6: 101,796,773 noncoding transcript Het
Grm1 A G 10: 10,782,633 F371S probably damaging Het
Gtdc1 T C 2: 44,591,956 I128V probably null Het
H2-Q3 T A 17: 35,359,732 noncoding transcript Het
Ibtk T C 9: 85,710,412 T998A probably benign Het
Ifi204 A G 1: 173,755,750 S301P probably damaging Het
Kcnn1 C A 8: 70,844,429 A545S probably benign Het
Keap1 T G 9: 21,237,553 S53R probably benign Het
Lat A G 7: 126,367,938 V138A probably benign Het
Lrpprc A T 17: 84,771,538 N249K probably benign Het
Lrrc40 A G 3: 158,063,835 I557V probably benign Het
Maml3 A G 3: 51,856,539 F335L probably benign Het
Mcmbp A T 7: 128,712,696 D265E probably damaging Het
Me3 A G 7: 89,633,014 H35R probably benign Het
Mif4gd C A 11: 115,609,637 V32L probably benign Het
Mlana T C 19: 29,700,151 S18P probably damaging Het
Mpnd T A 17: 56,010,268 probably benign Het
Ms4a4b T C 19: 11,454,737 V74A probably benign Het
Mta2 T C 19: 8,946,291 F133L possibly damaging Het
Myo5a A G 9: 75,123,048 M150V probably damaging Het
Nbr1 T C 11: 101,575,077 V487A probably benign Het
Nos3 G A 5: 24,377,855 C660Y probably damaging Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Olfr109 T C 17: 37,466,743 V179A probably damaging Het
Olfr186 A G 16: 59,027,445 L154P probably damaging Het
Olfr376 C T 11: 73,375,417 R223* probably null Het
Olfr669 A G 7: 104,938,742 D72G possibly damaging Het
Pcdh7 A G 5: 57,721,916 K938E probably damaging Het
Pcgf3 T C 5: 108,487,961 F166L probably benign Het
Pid1 A T 1: 84,038,260 V128E possibly damaging Het
Polr3a A C 14: 24,482,464 D187E probably benign Het
Prokr2 T C 2: 132,373,653 D135G probably damaging Het
Rnf141 T C 7: 110,825,320 T14A possibly damaging Het
Serinc1 T C 10: 57,523,045 E254G probably damaging Het
Skint11 T C 4: 114,191,510 F11L possibly damaging Het
Slc22a28 T C 19: 8,131,452 T109A probably benign Het
Sntg1 C A 1: 8,782,798 V43L probably damaging Het
Strn T C 17: 78,661,779 D398G probably damaging Het
Tacc2 A T 7: 130,625,899 E1438V probably damaging Het
Tas2r139 A G 6: 42,141,566 T211A possibly damaging Het
Tbkbp1 T C 11: 97,138,944 probably benign Het
Thbs3 T C 3: 89,226,431 Y897H probably damaging Het
Timm50 G T 7: 28,310,044 probably benign Het
Tmem132a T C 19: 10,866,934 Q100R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Unc93b1 C A 19: 3,935,871 T90K probably benign Het
Upk3bl T C 5: 136,057,245 probably benign Het
Vmn2r112 T A 17: 22,602,879 H179Q probably benign Het
Vmn2r57 A T 7: 41,400,495 F610Y probably damaging Het
Vmn2r80 T G 10: 79,194,698 L786R probably damaging Het
Zc3h14 A G 12: 98,759,824 T323A probably benign Het
Zfp532 T C 18: 65,625,066 I690T possibly damaging Het
Zfp729b T C 13: 67,596,672 N47S probably damaging Het
Other mutations in Adamtsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Adamtsl1 APN 4 86385640 missense probably benign 0.01
IGL00741:Adamtsl1 APN 4 86276948 missense probably damaging 1.00
IGL00770:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00774:Adamtsl1 APN 4 86388539 missense possibly damaging 0.65
IGL00826:Adamtsl1 APN 4 86156804 missense probably damaging 1.00
IGL00938:Adamtsl1 APN 4 86342278 missense possibly damaging 0.93
IGL01012:Adamtsl1 APN 4 86342189 missense possibly damaging 0.93
IGL01728:Adamtsl1 APN 4 86110837 missense probably damaging 1.00
IGL01801:Adamtsl1 APN 4 86199322 missense probably benign 0.23
IGL01922:Adamtsl1 APN 4 86249902 missense probably damaging 1.00
IGL02006:Adamtsl1 APN 4 86199345 missense probably damaging 1.00
IGL02192:Adamtsl1 APN 4 86228016 missense probably damaging 1.00
IGL02351:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02358:Adamtsl1 APN 4 86156873 critical splice donor site probably null
IGL02373:Adamtsl1 APN 4 86249805 missense probably damaging 1.00
IGL02660:Adamtsl1 APN 4 86232610 missense probably damaging 1.00
IGL02964:Adamtsl1 APN 4 86424357 missense probably damaging 1.00
IGL03233:Adamtsl1 APN 4 86342120 missense probably damaging 1.00
IGL03297:Adamtsl1 APN 4 86423426 missense probably damaging 0.98
IGL03326:Adamtsl1 APN 4 86252748 splice site probably benign
PIT4378001:Adamtsl1 UTSW 4 86199364 missense possibly damaging 0.93
PIT4418001:Adamtsl1 UTSW 4 86243724 missense probably damaging 1.00
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0131:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0132:Adamtsl1 UTSW 4 86342723 missense possibly damaging 0.94
R0453:Adamtsl1 UTSW 4 86232615 missense probably damaging 1.00
R0480:Adamtsl1 UTSW 4 86252818 missense probably benign 0.08
R0496:Adamtsl1 UTSW 4 86341198 missense probably damaging 1.00
R0538:Adamtsl1 UTSW 4 86343121 missense probably benign 0.27
R0547:Adamtsl1 UTSW 4 86356355 missense probably benign 0.37
R0567:Adamtsl1 UTSW 4 86228016 missense probably damaging 1.00
R0568:Adamtsl1 UTSW 4 86418552 missense probably damaging 1.00
R0639:Adamtsl1 UTSW 4 86277143 missense probably damaging 1.00
R0931:Adamtsl1 UTSW 4 86249847 missense probably benign 0.05
R1186:Adamtsl1 UTSW 4 86388509 missense probably benign 0.00
R1387:Adamtsl1 UTSW 4 86374993 splice site probably benign
R1459:Adamtsl1 UTSW 4 86425865 missense probably damaging 1.00
R1518:Adamtsl1 UTSW 4 86342603 missense probably damaging 0.99
R1532:Adamtsl1 UTSW 4 86248065 missense probably benign 0.02
R1603:Adamtsl1 UTSW 4 86415530 missense probably benign
R1931:Adamtsl1 UTSW 4 86342411 missense possibly damaging 0.62
R2086:Adamtsl1 UTSW 4 86228012 missense probably damaging 1.00
R2221:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2223:Adamtsl1 UTSW 4 86388525 missense probably benign 0.19
R2396:Adamtsl1 UTSW 4 86343119 nonsense probably null
R2397:Adamtsl1 UTSW 4 86199357 missense probably damaging 1.00
R2426:Adamtsl1 UTSW 4 86156788 missense probably benign 0.01
R3121:Adamtsl1 UTSW 4 86337009 missense probably damaging 1.00
R3715:Adamtsl1 UTSW 4 86216976 missense probably benign 0.01
R3848:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3849:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R3850:Adamtsl1 UTSW 4 86418546 missense probably damaging 1.00
R4194:Adamtsl1 UTSW 4 86054008 intron probably benign
R4354:Adamtsl1 UTSW 4 86156684 missense probably damaging 1.00
R4795:Adamtsl1 UTSW 4 86243769 critical splice donor site probably null
R4830:Adamtsl1 UTSW 4 86356382 missense probably damaging 0.97
R4874:Adamtsl1 UTSW 4 86342492 missense possibly damaging 0.94
R4939:Adamtsl1 UTSW 4 86243725 missense possibly damaging 0.95
R4942:Adamtsl1 UTSW 4 86341214 nonsense probably null
R4960:Adamtsl1 UTSW 4 86424173 nonsense probably null
R4971:Adamtsl1 UTSW 4 86336931 missense probably damaging 1.00
R5141:Adamtsl1 UTSW 4 86156850 missense possibly damaging 0.77
R5213:Adamtsl1 UTSW 4 86385628 missense possibly damaging 0.89
R5237:Adamtsl1 UTSW 4 86385669 critical splice donor site probably null
R5250:Adamtsl1 UTSW 4 86216945 nonsense probably null
R5411:Adamtsl1 UTSW 4 86388413 critical splice acceptor site probably null
R5554:Adamtsl1 UTSW 4 86276945 missense possibly damaging 0.69
R5631:Adamtsl1 UTSW 4 86276923 nonsense probably null
R5739:Adamtsl1 UTSW 4 86232664 missense probably damaging 1.00
R5905:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6028:Adamtsl1 UTSW 4 86342324 missense probably damaging 1.00
R6044:Adamtsl1 UTSW 4 86212691 missense probably damaging 1.00
R6261:Adamtsl1 UTSW 4 86336878 missense probably benign 0.09
R6300:Adamtsl1 UTSW 4 86248017 missense probably damaging 1.00
R6332:Adamtsl1 UTSW 4 86217011 missense probably damaging 0.96
R6560:Adamtsl1 UTSW 4 86336893 missense probably damaging 1.00
R6693:Adamtsl1 UTSW 4 86342886 missense probably benign 0.27
R6736:Adamtsl1 UTSW 4 86342247 missense probably damaging 1.00
R6964:Adamtsl1 UTSW 4 86156854 missense probably damaging 1.00
R7064:Adamtsl1 UTSW 4 86342041 missense possibly damaging 0.80
R7434:Adamtsl1 UTSW 4 86425878 missense probably damaging 0.99
R7477:Adamtsl1 UTSW 4 86415651 missense probably damaging 1.00
R7545:Adamtsl1 UTSW 4 85764855 missense probably damaging 1.00
R7556:Adamtsl1 UTSW 4 86277121 missense probably benign 0.19
R7580:Adamtsl1 UTSW 4 86054064 missense possibly damaging 0.53
R7593:Adamtsl1 UTSW 4 86341213 missense probably damaging 1.00
R7710:Adamtsl1 UTSW 4 86232573 missense
Predicted Primers PCR Primer
(F):5'- AGAATGTTCTCGTGCCTCTCAC -3'
(R):5'- GATCCTGCTCTATGGCTTGC -3'

Sequencing Primer
(F):5'- CTCGTGCCTCTCACATTAATATG -3'
(R):5'- GTTTGCTAGAAACAATCACCATGGG -3'
Posted On2016-04-27