Incidental Mutation 'R0333:Rslcan18'
ID 38350
Institutional Source Beutler Lab
Gene Symbol Rslcan18
Ensembl Gene ENSMUSG00000074824
Gene Name regulator of sex-limitation candidate 18
Synonyms
MMRRC Submission 038542-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock # R0333 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 67096613-67116263 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67098622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 309 (K309E)
Ref Sequence ENSEMBL: ENSMUSP00000089111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091526] [ENSMUST00000109743] [ENSMUST00000186303]
AlphaFold Q7M6X5
Predicted Effect probably damaging
Transcript: ENSMUST00000091526
AA Change: K309E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089111
Gene: ENSMUSG00000074824
AA Change: K309E

DomainStartEndE-ValueType
KRAB 96 156 5.31e-28 SMART
ZnF_C2H2 171 193 4.24e-4 SMART
ZnF_C2H2 199 221 1.56e-2 SMART
ZnF_C2H2 227 249 1.82e-3 SMART
ZnF_C2H2 255 277 1.82e-3 SMART
ZnF_C2H2 283 305 3.26e-5 SMART
ZnF_C2H2 311 333 1.82e-3 SMART
ZnF_C2H2 339 361 1.26e-2 SMART
ZnF_C2H2 367 389 2.12e-4 SMART
ZnF_C2H2 395 417 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109743
SMART Domains Protein: ENSMUSP00000105365
Gene: ENSMUSG00000058883

DomainStartEndE-ValueType
KRAB 17 77 3.75e-28 SMART
ZnF_C2H2 93 115 1.12e-3 SMART
ZnF_C2H2 121 143 5.14e-3 SMART
ZnF_C2H2 149 171 1.1e-2 SMART
ZnF_C2H2 177 199 6.78e-3 SMART
ZnF_C2H2 205 227 1.47e-3 SMART
ZnF_C2H2 233 255 7.78e-3 SMART
ZnF_C2H2 261 283 1.95e-3 SMART
ZnF_C2H2 289 311 5.21e-4 SMART
ZnF_C2H2 317 339 7.9e-4 SMART
ZnF_C2H2 345 367 8.34e-3 SMART
ZnF_C2H2 373 395 1.3e-4 SMART
ZnF_C2H2 401 423 4.87e-4 SMART
ZnF_C2H2 429 451 5.14e-3 SMART
ZnF_C2H2 457 479 1.2e-3 SMART
ZnF_C2H2 485 507 1.72e-4 SMART
ZnF_C2H2 513 535 1.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185954
Predicted Effect probably damaging
Transcript: ENSMUST00000186303
AA Change: K185E

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140296
Gene: ENSMUSG00000100235
AA Change: K185E

DomainStartEndE-ValueType
KRAB 1 32 9.7e-3 SMART
ZnF_C2H2 47 69 1.8e-6 SMART
ZnF_C2H2 75 97 6.7e-5 SMART
ZnF_C2H2 103 125 7.6e-6 SMART
ZnF_C2H2 131 153 7.6e-6 SMART
ZnF_C2H2 159 181 1.4e-7 SMART
ZnF_C2H2 187 209 7.6e-6 SMART
ZnF_C2H2 215 237 5.5e-5 SMART
ZnF_C2H2 243 265 8.9e-7 SMART
ZnF_C2H2 271 293 2e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225558
Meta Mutation Damage Score 0.1441 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 T C 9: 106,241,281 N214S probably benign Het
Antxr1 A G 6: 87,188,838 probably benign Het
Atxn7l3 A T 11: 102,294,992 probably null Het
Cab39l A G 14: 59,499,611 E60G probably damaging Het
Cdc5l G T 17: 45,393,216 probably benign Het
Cux2 T C 5: 121,860,608 E1423G probably benign Het
Dbndd1 G T 8: 123,506,773 Q165K probably damaging Het
Drd1 C A 13: 54,054,063 C37F probably damaging Het
Elp3 G A 14: 65,590,593 P11L probably benign Het
F830045P16Rik A G 2: 129,472,857 Y167H probably damaging Het
Gimap3 G A 6: 48,765,730 Q89* probably null Het
Herc1 G A 9: 66,464,699 probably null Het
Hist3h2a C A 11: 58,954,859 S41* probably null Het
Ipo11 A G 13: 106,870,763 V603A probably benign Het
Kifap3 G A 1: 163,797,264 A130T probably damaging Het
Klhl23 A G 2: 69,833,897 Y530C probably damaging Het
Map4k1 C T 7: 28,999,761 probably benign Het
Mroh2b T A 15: 4,931,118 L778M probably damaging Het
Mtdh T C 15: 34,118,101 S344P possibly damaging Het
Ncoa3 T G 2: 166,054,291 N371K probably damaging Het
Ncor2 C A 5: 125,034,344 probably benign Het
Nrn1l A G 8: 105,894,420 E48G probably benign Het
Nudcd1 A G 15: 44,401,287 I271T probably benign Het
Olfr23 A T 11: 73,940,767 I174F possibly damaging Het
Olfr31 T C 14: 14,328,498 L129P probably damaging Het
Pard3b A G 1: 62,230,212 N653S probably benign Het
Park2 T C 17: 11,067,140 F6L probably damaging Het
Plekhg1 A C 10: 3,964,419 K1380N probably damaging Het
Ppara T A 15: 85,790,960 I210N probably damaging Het
Ppp2r5b A G 19: 6,229,047 probably benign Het
Prr14l A G 5: 32,827,993 L1386P probably damaging Het
Ralgapa1 A G 12: 55,782,900 probably benign Het
Reln A T 5: 21,929,242 L2563I probably damaging Het
Rps7 A G 12: 28,631,201 probably benign Het
Sec14l5 C T 16: 5,167,066 T92M probably damaging Het
Slc22a8 G A 19: 8,608,150 probably benign Het
Smad2 G A 18: 76,262,621 A44T probably damaging Het
Smcr8 T C 11: 60,780,222 V732A possibly damaging Het
Spata2l A G 8: 123,233,632 F306S probably damaging Het
Stab2 T C 10: 86,841,627 D2552G probably benign Het
Tctn3 A T 19: 40,607,267 L358H possibly damaging Het
Tk2 C T 8: 104,248,514 probably benign Het
Tm6sf2 C T 8: 70,077,914 R215C probably damaging Het
Tmbim6 T C 15: 99,406,674 I204T probably damaging Het
Tubgcp2 C A 7: 139,999,347 W675C probably damaging Het
Usp48 T A 4: 137,594,483 I62N probably damaging Het
Vmn2r74 T C 7: 85,952,283 T716A probably benign Het
Vps13b C A 15: 35,879,803 T3008K probably damaging Het
Wnk1 G A 6: 119,928,163 probably benign Het
Other mutations in Rslcan18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01520:Rslcan18 APN 13 67102108 missense probably benign 0.01
IGL01760:Rslcan18 APN 13 67113951 missense probably benign 0.04
R0003:Rslcan18 UTSW 13 67098469 missense probably benign 0.01
R0505:Rslcan18 UTSW 13 67102119 missense probably benign 0.31
R0525:Rslcan18 UTSW 13 67112258 missense probably benign 0.03
R0898:Rslcan18 UTSW 13 67098816 missense probably benign 0.02
R1449:Rslcan18 UTSW 13 67102100 missense possibly damaging 0.65
R1511:Rslcan18 UTSW 13 67098952 missense possibly damaging 0.94
R1575:Rslcan18 UTSW 13 67108057 intron probably benign
R1973:Rslcan18 UTSW 13 67108023 intron probably benign
R3109:Rslcan18 UTSW 13 67098607 missense possibly damaging 0.53
R4707:Rslcan18 UTSW 13 67098526 missense probably damaging 1.00
R5277:Rslcan18 UTSW 13 67098434 missense probably benign 0.03
R8887:Rslcan18 UTSW 13 67098729 missense probably damaging 1.00
R9472:Rslcan18 UTSW 13 67112232 missense probably benign 0.11
R9475:Rslcan18 UTSW 13 67102064 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTAAAGCACTCTCcacactcatcaca -3'
(R):5'- GCTTTTCTTCTTATCTCAACTTCTACTCACca -3'

Sequencing Primer
(F):5'- gctttgccacattcttcacattc -3'
(R):5'- ccctccatacttcataaccacc -3'
Posted On 2013-05-23