Incidental Mutation 'R4947:Ibtk'
ID383510
Institutional Source Beutler Lab
Gene Symbol Ibtk
Ensembl Gene ENSMUSG00000035941
Gene Nameinhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms5430411K16Rik
MMRRC Submission 042544-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4947 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location85687360-85749334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85710412 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 998 (T998A)
Ref Sequence ENSEMBL: ENSMUSP00000041145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039213] [ENSMUST00000187521]
Predicted Effect probably benign
Transcript: ENSMUST00000039213
AA Change: T998A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000041145
Gene: ENSMUSG00000035941
AA Change: T998A

DomainStartEndE-ValueType
ANK 51 80 2e0 SMART
ANK 85 114 2.58e-3 SMART
Pfam:RCC1 143 192 8.1e-10 PFAM
Pfam:RCC1 195 244 1.1e-14 PFAM
Pfam:RCC1 247 299 5.3e-13 PFAM
low complexity region 307 318 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
BTB 565 745 5.48e-13 SMART
BTB 769 872 4.09e-12 SMART
low complexity region 977 990 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186322
Predicted Effect probably benign
Transcript: ENSMUST00000187521
SMART Domains Protein: ENSMUSP00000139424
Gene: ENSMUSG00000035941

DomainStartEndE-ValueType
ANK 51 80 1.3e-2 SMART
ANK 85 114 1.7e-5 SMART
Pfam:RCC1 143 192 1.9e-8 PFAM
Pfam:RCC1 195 244 1.4e-12 PFAM
Pfam:RCC1 247 299 2.7e-10 PFAM
low complexity region 307 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188768
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.0%
  • 20x: 87.4%
Validation Efficiency 100% (88/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bruton tyrosine kinase (BTK) is a protein tyrosine kinase that is expressed in B cells, macrophages, and neutrophils. The protein encoded by this gene binds to BTK and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. This gene has a pseudogene on chromosome 18. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more sustained calcium fluxes in spleen cells stimulated with IgM. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik T A 7: 131,357,614 H119L probably damaging Het
Acvr1c T A 2: 58,315,975 Q41L probably benign Het
Adamtsl1 A T 4: 85,764,800 Q36L possibly damaging Het
Als2cr12 T A 1: 58,676,539 T173S probably benign Het
BC117090 T C 16: 36,321,765 Y83C probably damaging Het
Bcl2a1a G A 9: 88,957,282 E78K probably damaging Het
C130026I21Rik G A 1: 85,112,482 A124V probably damaging Het
Cdk5rap2 A G 4: 70,228,592 probably null Het
Copg1 C A 6: 87,903,473 probably benign Het
Crb2 C T 2: 37,795,331 probably benign Het
Ctbp2 C A 7: 132,999,283 G584C probably damaging Het
Cyp11b2 T C 15: 74,851,570 N415S possibly damaging Het
D630003M21Rik T A 2: 158,186,196 T1095S unknown Het
D630045J12Rik C T 6: 38,148,543 R1512H probably damaging Het
Dnah5 T A 15: 28,272,372 V1078E probably benign Het
Donson A T 16: 91,682,551 D366E probably damaging Het
Evpl T C 11: 116,223,375 E1163G possibly damaging Het
Fcgbp A G 7: 28,089,812 K601R probably benign Het
Fez1 A C 9: 36,868,875 I323L probably damaging Het
Fmnl2 T G 2: 53,073,710 S285A probably benign Het
Frem1 A G 4: 82,966,134 S1194P probably damaging Het
Gm10754 A T 10: 97,682,148 probably benign Het
Gm14226 A T 2: 155,024,959 T279S probably benign Het
Gm16332 G A 1: 139,865,992 noncoding transcript Het
Gm21718 T A 14: 51,315,959 noncoding transcript Het
Gm9866 A T 12: 27,160,228 noncoding transcript Het
Gm9871 A G 6: 101,796,773 noncoding transcript Het
Grm1 A G 10: 10,782,633 F371S probably damaging Het
Gtdc1 T C 2: 44,591,956 I128V probably null Het
H2-Q3 T A 17: 35,359,732 noncoding transcript Het
Ifi204 A G 1: 173,755,750 S301P probably damaging Het
Kcnn1 C A 8: 70,844,429 A545S probably benign Het
Keap1 T G 9: 21,237,553 S53R probably benign Het
Lat A G 7: 126,367,938 V138A probably benign Het
Lrpprc A T 17: 84,771,538 N249K probably benign Het
Lrrc40 A G 3: 158,063,835 I557V probably benign Het
Maml3 A G 3: 51,856,539 F335L probably benign Het
Mcmbp A T 7: 128,712,696 D265E probably damaging Het
Me3 A G 7: 89,633,014 H35R probably benign Het
Mif4gd C A 11: 115,609,637 V32L probably benign Het
Mlana T C 19: 29,700,151 S18P probably damaging Het
Mpnd T A 17: 56,010,268 probably benign Het
Ms4a4b T C 19: 11,454,737 V74A probably benign Het
Mta2 T C 19: 8,946,291 F133L possibly damaging Het
Myo5a A G 9: 75,123,048 M150V probably damaging Het
Nbr1 T C 11: 101,575,077 V487A probably benign Het
Nos3 G A 5: 24,377,855 C660Y probably damaging Het
Ocln T C 13: 100,539,715 D90G probably damaging Het
Olfr109 T C 17: 37,466,743 V179A probably damaging Het
Olfr186 A G 16: 59,027,445 L154P probably damaging Het
Olfr376 C T 11: 73,375,417 R223* probably null Het
Olfr669 A G 7: 104,938,742 D72G possibly damaging Het
Pcdh7 A G 5: 57,721,916 K938E probably damaging Het
Pcgf3 T C 5: 108,487,961 F166L probably benign Het
Pid1 A T 1: 84,038,260 V128E possibly damaging Het
Polr3a A C 14: 24,482,464 D187E probably benign Het
Prokr2 T C 2: 132,373,653 D135G probably damaging Het
Rnf141 T C 7: 110,825,320 T14A possibly damaging Het
Serinc1 T C 10: 57,523,045 E254G probably damaging Het
Skint11 T C 4: 114,191,510 F11L possibly damaging Het
Slc22a28 T C 19: 8,131,452 T109A probably benign Het
Sntg1 C A 1: 8,782,798 V43L probably damaging Het
Strn T C 17: 78,661,779 D398G probably damaging Het
Tacc2 A T 7: 130,625,899 E1438V probably damaging Het
Tas2r139 A G 6: 42,141,566 T211A possibly damaging Het
Tbkbp1 T C 11: 97,138,944 probably benign Het
Thbs3 T C 3: 89,226,431 Y897H probably damaging Het
Timm50 G T 7: 28,310,044 probably benign Het
Tmem132a T C 19: 10,866,934 Q100R possibly damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Unc93b1 C A 19: 3,935,871 T90K probably benign Het
Upk3bl T C 5: 136,057,245 probably benign Het
Vmn2r112 T A 17: 22,602,879 H179Q probably benign Het
Vmn2r57 A T 7: 41,400,495 F610Y probably damaging Het
Vmn2r80 T G 10: 79,194,698 L786R probably damaging Het
Zc3h14 A G 12: 98,759,824 T323A probably benign Het
Zfp532 T C 18: 65,625,066 I690T possibly damaging Het
Zfp729b T C 13: 67,596,672 N47S probably damaging Het
Other mutations in Ibtk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ibtk APN 9 85717545 splice site probably null
IGL00852:Ibtk APN 9 85713601 missense probably benign 0.01
IGL00907:Ibtk APN 9 85690331 missense possibly damaging 0.51
IGL01101:Ibtk APN 9 85732622 splice site probably benign
IGL02125:Ibtk APN 9 85735070 missense probably damaging 1.00
IGL02214:Ibtk APN 9 85714179 splice site probably benign
IGL02223:Ibtk APN 9 85710366 splice site probably benign
IGL02638:Ibtk APN 9 85719893 missense probably damaging 1.00
IGL02741:Ibtk APN 9 85726612 missense probably damaging 1.00
IGL03299:Ibtk APN 9 85721136 missense probably benign 0.27
IGL03493:Ibtk APN 9 85718919 missense probably benign 0.44
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0558:Ibtk UTSW 9 85737538 missense probably damaging 0.99
R0569:Ibtk UTSW 9 85708181 splice site probably benign
R0932:Ibtk UTSW 9 85735046 missense probably damaging 1.00
R0973:Ibtk UTSW 9 85743577 missense probably damaging 1.00
R1237:Ibtk UTSW 9 85720748 missense probably benign 0.00
R1245:Ibtk UTSW 9 85720742 critical splice donor site probably null
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1921:Ibtk UTSW 9 85703082 missense probably benign
R2090:Ibtk UTSW 9 85720993 missense probably benign 0.01
R2109:Ibtk UTSW 9 85706550 missense probably benign
R2277:Ibtk UTSW 9 85703151 missense probably benign
R2437:Ibtk UTSW 9 85708125 missense probably benign 0.27
R2446:Ibtk UTSW 9 85703073 missense probably benign 0.22
R3107:Ibtk UTSW 9 85710414 missense probably damaging 1.00
R3876:Ibtk UTSW 9 85718426 missense probably benign 0.06
R4160:Ibtk UTSW 9 85703090 missense probably benign 0.01
R4273:Ibtk UTSW 9 85726731 missense probably damaging 1.00
R4321:Ibtk UTSW 9 85735072 missense possibly damaging 0.49
R4827:Ibtk UTSW 9 85728554 missense probably benign 0.04
R5228:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5268:Ibtk UTSW 9 85743690 missense probably benign 0.00
R5327:Ibtk UTSW 9 85737466 critical splice donor site probably null
R5344:Ibtk UTSW 9 85735004 missense possibly damaging 0.90
R5414:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5502:Ibtk UTSW 9 85720863 missense probably benign 0.13
R5756:Ibtk UTSW 9 85731254 missense possibly damaging 0.51
R7144:Ibtk UTSW 9 85743691 missense probably benign 0.03
R7196:Ibtk UTSW 9 85743656 missense probably damaging 1.00
R7490:Ibtk UTSW 9 85718934 critical splice acceptor site probably null
R7571:Ibtk UTSW 9 85722300 missense probably benign
R7757:Ibtk UTSW 9 85697237 missense possibly damaging 0.87
R8007:Ibtk UTSW 9 85690717 missense not run
R8065:Ibtk UTSW 9 85720863 missense probably benign 0.13
X0021:Ibtk UTSW 9 85697174 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- CTGCATGCATCTTTTACAGTTTCAG -3'
(R):5'- GTTAGTGATTTGCCCAGCCC -3'

Sequencing Primer
(F):5'- GCAGCAATTAAAGGCTCTTGC -3'
(R):5'- CCTTCCTGGGCGTATGTATAGC -3'
Posted On2016-04-27