Mutagenetix > Incidental Mutation

Incidental Mutation 'R4948:Pik3c2b'

383546

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2b

Ensembl Gene

ENSMUSG00000026447

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta

Synonyms

C330011J12Rik, PI3K-C2beta

MMRRC Submission

042545-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.250) question?

Stock #

R4948 (G1)

Quality Score

195

Status

Validated

Chromosome

Chromosomal Location

133045667-133108687 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 133099715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000076911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077730]

AlphaFold

E9QAN8

Predicted Effect

probably null
Transcript: ENSMUST00000077730

SMART Domains

Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

Domain	Start	End	E-Value	Type
low complexity region	155	160	N/A	INTRINSIC
low complexity region	168	183	N/A	INTRINSIC
PI3K_rbd	363	465	2.15e-19	SMART
PI3K_C2	618	726	6.17e-29	SMART
PI3Ka	804	990	1.66e-84	SMART
PI3Kc	1078	1340	3.45e-132	SMART
PX	1364	1476	9.44e-27	SMART
low complexity region	1481	1492	N/A	INTRINSIC
C2	1517	1622	1.82e-18	SMART

Meta Mutation Damage Score

0.9488

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.3%
20x: 92.2%

Validation Efficiency

94% (103/109)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 100 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610318N02Rik	A	T	16: 17,118,290		probably null	Het
Adcy4	C	T	14: 55,779,029	D322N	probably damaging	Het
Alas1	A	T	9: 106,246,878	L27*	probably null	Het
Aldh1a7	A	G	19: 20,727,010	V40A	possibly damaging	Het
Appbp2	A	T	11: 85,194,583	I499K	possibly damaging	Het
B3gnt5	A	C	16: 19,769,144	M38L	probably benign	Het
Brd8	A	G	18: 34,614,532	V92A	probably damaging	Het
Btla	A	T	16: 45,242,728	E151D	probably benign	Het
C87499	A	T	4: 88,628,948	L162H	probably damaging	Het
Cd79b	T	A	11: 106,312,861	T67S	probably benign	Het
Cep192	A	G	18: 67,816,804	R320G	probably benign	Het
Chad	A	C	11: 94,565,702	D202A	probably damaging	Het
Chil6	A	G	3: 106,388,672		probably benign	Het
Cpz	T	C	5: 35,517,404	E167G	possibly damaging	Het
Crisp2	T	G	17: 40,765,268	H225P	probably damaging	Het
Cyp2c23	T	C	19: 44,021,699	Y69C	possibly damaging	Het
Dcp1a	T	A	14: 30,479,767	L49H	probably damaging	Het
Dnah6	T	A	6: 73,053,689	H3380L	probably benign	Het
Dnm2	A	G	9: 21,504,533	D721G	possibly damaging	Het
Dnpep	G	T	1: 75,316,760	T15K	probably benign	Het
Dock3	A	T	9: 106,991,155	D643E	probably damaging	Het
Ear6	C	T	14: 51,854,116	T40I	possibly damaging	Het
Fancm	A	G	12: 65,090,974	D313G	probably damaging	Het
Fbxw16	T	A	9: 109,438,347	E272V	probably damaging	Het
Frmd4b	T	A	6: 97,306,730	E393D	probably benign	Het
Fryl	T	A	5: 73,089,130	M1100L	probably benign	Het
Gjc1	T	C	11: 102,800,421	H252R	probably damaging	Het
Gm10518	T	C	1: 179,803,912		probably benign	Het
Gna14	A	G	19: 16,603,292	M165V	probably benign	Het
Hells	C	A	19: 38,935,522	Q72K	probably damaging	Het
Herc1	A	G	9: 66,484,902	I4031V	probably benign	Het
Hspa2	C	T	12: 76,405,987	A485V	probably damaging	Het
Ighv1-54	T	A	12: 115,193,818	I70F	probably benign	Het
Il20rb	A	T	9: 100,461,539		probably benign	Het
Krt1	C	A	15: 101,845,941	V625L	unknown	Het
Lamc3	T	C	2: 31,940,736	I1495T	probably benign	Het
Larp6	A	G	9: 60,737,780	E401G	possibly damaging	Het
Ldha	A	T	7: 46,847,381	H19L	probably benign	Het
Lrba	A	G	3: 86,285,028	N83S	probably damaging	Het
Lrp4	G	T	2: 91,485,886	R783L	probably benign	Het
Lrrk2	T	G	15: 91,803,389	I2227S	probably benign	Het
Lvrn	T	C	18: 46,880,736	L495P	probably damaging	Het
Macf1	T	C	4: 123,497,755	N1077S	probably damaging	Het
Mboat1	A	G	13: 30,241,230	T425A	probably damaging	Het
Mcam	A	G	9: 44,136,566	E36G	probably damaging	Het
Meis1	T	A	11: 19,016,308	T22S	probably benign	Het
Micu1	A	G	10: 59,863,254	K451R	possibly damaging	Het
Mrvi1	A	G	7: 110,888,029	V498A	probably damaging	Het
Nat8	A	T	6: 85,830,523	D209E	probably benign	Het
Nek10	T	A	14: 14,860,986	L513M	possibly damaging	Het
Nmral1	G	A	16: 4,716,410	R56*	probably null	Het
Ofcc1	G	A	13: 40,015,388	T841I	probably damaging	Het
Olfr1002	T	C	2: 85,647,572	I250V	probably benign	Het
Olfr1408	A	G	1: 173,130,959	V86A	probably benign	Het
Olfr1451	A	T	19: 12,999,831	T282S	probably benign	Het
Olfr192	G	A	16: 59,098,977	T5I	probably damaging	Het
Palm3	A	T	8: 84,027,079	R132*	probably null	Het
Pax2	A	G	19: 44,816,040	Y272C	probably damaging	Het
Phc2	G	A	4: 128,723,115	A394T	probably benign	Het
Phf2	C	A	13: 48,807,722	G831C	unknown	Het
Plin2	T	A	4: 86,661,991	I178F	probably benign	Het
Prdm14	T	A	1: 13,122,631	I295F	probably damaging	Het
Psmd5	C	T	2: 34,870,783	R47H	probably benign	Het
Ptchd3	T	A	11: 121,842,516	I744K	probably damaging	Het
Ptrh1	T	A	2: 32,776,545		probably benign	Het
Rab6a	A	G	7: 100,628,420	D49G	probably damaging	Het
Radil	A	T	5: 142,485,239	D1062E	probably benign	Het
Robo2	A	G	16: 74,352,838	V34A	possibly damaging	Het
Sall3	G	A	18: 80,971,411	P1029S	probably benign	Het
Sec14l3	A	G	11: 4,068,101	D127G	possibly damaging	Het
Sel1l2	A	G	2: 140,244,166	Y502H	probably damaging	Het
Serpina1f	A	G	12: 103,689,751	V406A	probably damaging	Het
Sf3b3	T	C	8: 110,813,669	D1040G	probably damaging	Het
Sgcd	A	G	11: 46,979,435	I233T	possibly damaging	Het
Slc15a3	A	G	19: 10,843,046	Q9R	probably benign	Het
Slc25a46	A	G	18: 31,583,283	F389L	probably damaging	Het
Slc26a2	G	T	18: 61,198,258	C700*	probably null	Het
Slc4a7	A	G	14: 14,771,283	Y671C	possibly damaging	Het
Slc5a10	A	T	11: 61,719,882	I22N	probably damaging	Het
Slc5a9	C	A	4: 111,891,744		probably null	Het
Slc6a12	A	G	6: 121,355,322	D205G	probably benign	Het
Tas2r115	G	A	6: 132,737,161	H276Y	probably damaging	Het
Tdpoz4	T	A	3: 93,797,011	I205N	probably damaging	Het
Tfeb	C	T	17: 47,785,979	T33I	probably benign	Het
Tgm3	A	G	2: 130,048,320	T668A	probably benign	Het
Tnpo3	A	G	6: 29,582,260	V201A	probably benign	Het
Tpcn1	T	A	5: 120,556,531	M158L	probably benign	Het
Trim47	A	C	11: 116,106,092	L612R	probably damaging	Het
Trmt10c	A	T	16: 56,034,075	L399*	probably null	Het
Trpm2	A	T	10: 77,917,792	S1293T	probably benign	Het
Ttn	C	T	2: 76,752,597	V22651I	probably damaging	Het
Tubgcp5	A	G	7: 55,806,123	I300V	probably benign	Het
Uty	T	A	Y: 1,136,883	Q844L	probably damaging	Het
Vmn2r85	C	T	10: 130,419,121	E565K	probably damaging	Het
Vmn2r97	T	C	17: 18,947,299	V605A	possibly damaging	Het
Vwa3a	T	C	7: 120,776,264	V399A	probably damaging	Het
Wdr63	T	A	3: 146,083,065	K254*	probably null	Het
Wnk4	G	A	11: 101,268,281	R508Q	probably damaging	Het
Zfp217	A	G	2: 170,119,210	V399A	probably damaging	Het
Zfp616	T	A	11: 74,084,004	N457K	possibly damaging	Het

Other mutations in Pik3c2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01086:Pik3c2b	APN	1	133091618	missense	probably damaging	0.98
IGL01288:Pik3c2b	APN	1	133094805	missense	probably damaging	0.96
IGL01313:Pik3c2b	APN	1	133071631	nonsense	probably null
IGL01367:Pik3c2b	APN	1	133105988	missense	probably benign	0.02
IGL02379:Pik3c2b	APN	1	133094791	missense	probably damaging	1.00
IGL02638:Pik3c2b	APN	1	133077318	splice site	probably benign
IGL02728:Pik3c2b	APN	1	133092327	missense	probably benign	0.09
IGL02992:Pik3c2b	APN	1	133066980	nonsense	probably null
IGL03121:Pik3c2b	APN	1	133079745	missense	probably benign	0.00
R0453:Pik3c2b	UTSW	1	133077396	missense	probably damaging	1.00
R0518:Pik3c2b	UTSW	1	133105992	missense	probably damaging	1.00
R0616:Pik3c2b	UTSW	1	133100831	missense	probably damaging	1.00
R0659:Pik3c2b	UTSW	1	133071200	missense	probably damaging	0.99
R1542:Pik3c2b	UTSW	1	133090034	missense	probably damaging	1.00
R1716:Pik3c2b	UTSW	1	133094826	missense	probably damaging	1.00
R1728:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1729:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1730:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1739:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1762:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1783:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1784:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1785:Pik3c2b	UTSW	1	133066627	missense	probably benign	0.00
R1816:Pik3c2b	UTSW	1	133101370	missense	probably benign	0.00
R1897:Pik3c2b	UTSW	1	133066916	missense	possibly damaging	0.57
R2006:Pik3c2b	UTSW	1	133066544	missense	probably damaging	1.00
R2067:Pik3c2b	UTSW	1	133099611	missense	probably damaging	1.00
R2271:Pik3c2b	UTSW	1	133103428	missense	probably benign
R2294:Pik3c2b	UTSW	1	133066775	missense	probably damaging	1.00
R2320:Pik3c2b	UTSW	1	133103413	missense	probably damaging	1.00
R4735:Pik3c2b	UTSW	1	133067049	missense	probably benign	0.25
R4926:Pik3c2b	UTSW	1	133099626	nonsense	probably null
R4997:Pik3c2b	UTSW	1	133105081	missense	probably damaging	1.00
R5304:Pik3c2b	UTSW	1	133070408	missense	possibly damaging	0.50
R5461:Pik3c2b	UTSW	1	133099702	missense	possibly damaging	0.66
R5722:Pik3c2b	UTSW	1	133103836	missense	probably damaging	1.00
R5971:Pik3c2b	UTSW	1	133074627	splice site	probably null
R5980:Pik3c2b	UTSW	1	133088308	missense	probably benign	0.43
R6036:Pik3c2b	UTSW	1	133090713	missense	possibly damaging	0.95
R6138:Pik3c2b	UTSW	1	133074627	splice site	probably null
R6223:Pik3c2b	UTSW	1	133070357	missense	probably damaging	1.00
R6273:Pik3c2b	UTSW	1	133066711	missense	probably benign	0.02
R6742:Pik3c2b	UTSW	1	133075821	missense	probably benign
R6954:Pik3c2b	UTSW	1	133066303	missense	possibly damaging	0.50
R6998:Pik3c2b	UTSW	1	133102372	missense	probably benign	0.23
R7103:Pik3c2b	UTSW	1	133105974	missense	probably damaging	1.00
R7133:Pik3c2b	UTSW	1	133090234	missense	possibly damaging	0.73
R7161:Pik3c2b	UTSW	1	133106112	missense	probably damaging	0.98
R7183:Pik3c2b	UTSW	1	133066465	missense	probably benign	0.00
R7193:Pik3c2b	UTSW	1	133079774	missense	probably benign	0.00
R7252:Pik3c2b	UTSW	1	133094734	missense	probably benign	0.19
R7263:Pik3c2b	UTSW	1	133090202	missense	probably damaging	0.98
R7404:Pik3c2b	UTSW	1	133090706	missense	probably damaging	1.00
R7709:Pik3c2b	UTSW	1	133079841	critical splice donor site	probably null
R7712:Pik3c2b	UTSW	1	133085611	missense	probably damaging	1.00
R7823:Pik3c2b	UTSW	1	133102305	missense	probably damaging	1.00
R7831:Pik3c2b	UTSW	1	133071242	missense	possibly damaging	0.94
R7913:Pik3c2b	UTSW	1	133090061	critical splice donor site	probably null
R7916:Pik3c2b	UTSW	1	133100904	missense	probably benign	0.30
R7960:Pik3c2b	UTSW	1	133103849	missense	probably damaging	1.00
R7981:Pik3c2b	UTSW	1	133075809	critical splice acceptor site	probably null
R8346:Pik3c2b	UTSW	1	133090246	missense	probably damaging	0.97
R8938:Pik3c2b	UTSW	1	133088330	missense	probably benign	0.19
R8997:Pik3c2b	UTSW	1	133090779	missense	possibly damaging	0.83
R9416:Pik3c2b	UTSW	1	133077449	missense	probably damaging	1.00
R9598:Pik3c2b	UTSW	1	133084987	critical splice donor site	probably null
R9621:Pik3c2b	UTSW	1	133071607	missense	probably damaging	1.00
R9742:Pik3c2b	UTSW	1	133094749	missense	probably damaging	1.00
R9776:Pik3c2b	UTSW	1	133090850	missense	possibly damaging	0.64
R9786:Pik3c2b	UTSW	1	133091600	missense	possibly damaging	0.94
U15987:Pik3c2b	UTSW	1	133074627	splice site	probably null
X0060:Pik3c2b	UTSW	1	133084936	missense	probably benign	0.18
Z1176:Pik3c2b	UTSW	1	133066553	missense	probably damaging	1.00
Z1176:Pik3c2b	UTSW	1	133099686	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGCCTATAACCCCAATCAGG -3'
(R):5'- ATACATATTGGCCTCAGAATGCAG -3'

Sequencing Primer
(F):5'- TTGTATAGAAAACCCTGGCCTACGG -3'
(R):5'- TATTGGCCTCAGAATGCAGACAGG -3'

Posted On

2016-04-27