Incidental Mutation 'R4948:Pik3c2b'
ID 383546
Institutional Source Beutler Lab
Gene Symbol Pik3c2b
Ensembl Gene ENSMUSG00000026447
Gene Name phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms PI3K-C2beta, C330011J12Rik
MMRRC Submission 042545-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.253) question?
Stock # R4948 (G1)
Quality Score 195
Status Validated
Chromosome 1
Chromosomal Location 132973410-133036429 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 133027453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077730]
AlphaFold E9QAN8
Predicted Effect probably null
Transcript: ENSMUST00000077730
SMART Domains Protein: ENSMUSP00000076911
Gene: ENSMUSG00000026447

DomainStartEndE-ValueType
low complexity region 155 160 N/A INTRINSIC
low complexity region 168 183 N/A INTRINSIC
PI3K_rbd 363 465 2.15e-19 SMART
PI3K_C2 618 726 6.17e-29 SMART
PI3Ka 804 990 1.66e-84 SMART
PI3Kc 1078 1340 3.45e-132 SMART
PX 1364 1476 9.44e-27 SMART
low complexity region 1481 1492 N/A INTRINSIC
C2 1517 1622 1.82e-18 SMART
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal epidermal growth, differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 16,936,154 (GRCm39) probably null Het
Adcy4 C T 14: 56,016,486 (GRCm39) D322N probably damaging Het
Alas1 A T 9: 106,124,077 (GRCm39) L27* probably null Het
Aldh1a7 A G 19: 20,704,374 (GRCm39) V40A possibly damaging Het
Appbp2 A T 11: 85,085,409 (GRCm39) I499K possibly damaging Het
B3gnt5 A C 16: 19,587,894 (GRCm39) M38L probably benign Het
Brd8 A G 18: 34,747,585 (GRCm39) V92A probably damaging Het
Btla A T 16: 45,063,091 (GRCm39) E151D probably benign Het
Cd79b T A 11: 106,203,687 (GRCm39) T67S probably benign Het
Cep192 A G 18: 67,949,875 (GRCm39) R320G probably benign Het
Chad A C 11: 94,456,528 (GRCm39) D202A probably damaging Het
Chil6 A G 3: 106,295,988 (GRCm39) probably benign Het
Cpz T C 5: 35,674,748 (GRCm39) E167G possibly damaging Het
Crisp2 T G 17: 41,076,159 (GRCm39) H225P probably damaging Het
Cyp2c23 T C 19: 44,010,138 (GRCm39) Y69C possibly damaging Het
Dcp1a T A 14: 30,201,724 (GRCm39) L49H probably damaging Het
Dnah6 T A 6: 73,030,672 (GRCm39) H3380L probably benign Het
Dnai3 T A 3: 145,788,820 (GRCm39) K254* probably null Het
Dnm2 A G 9: 21,415,829 (GRCm39) D721G possibly damaging Het
Dnpep G T 1: 75,293,404 (GRCm39) T15K probably benign Het
Dock3 A T 9: 106,868,354 (GRCm39) D643E probably damaging Het
Ear6 C T 14: 52,091,573 (GRCm39) T40I possibly damaging Het
Fancm A G 12: 65,137,748 (GRCm39) D313G probably damaging Het
Fbxw16 T A 9: 109,267,415 (GRCm39) E272V probably damaging Het
Frmd4b T A 6: 97,283,691 (GRCm39) E393D probably benign Het
Fryl T A 5: 73,246,473 (GRCm39) M1100L probably benign Het
Gjd3 T C 11: 102,691,247 (GRCm39) H252R probably damaging Het
Gm10518 T C 1: 179,631,477 (GRCm39) probably benign Het
Gna14 A G 19: 16,580,656 (GRCm39) M165V probably benign Het
Hells C A 19: 38,923,966 (GRCm39) Q72K probably damaging Het
Herc1 A G 9: 66,392,184 (GRCm39) I4031V probably benign Het
Hspa2 C T 12: 76,452,761 (GRCm39) A485V probably damaging Het
Ighv1-54 T A 12: 115,157,438 (GRCm39) I70F probably benign Het
Il20rb A T 9: 100,343,592 (GRCm39) probably benign Het
Irag1 A G 7: 110,487,236 (GRCm39) V498A probably damaging Het
Krt1 C A 15: 101,754,376 (GRCm39) V625L unknown Het
Lamc3 T C 2: 31,830,748 (GRCm39) I1495T probably benign Het
Larp6 A G 9: 60,645,063 (GRCm39) E401G possibly damaging Het
Ldha A T 7: 46,496,805 (GRCm39) H19L probably benign Het
Lrba A G 3: 86,192,335 (GRCm39) N83S probably damaging Het
Lrp4 G T 2: 91,316,231 (GRCm39) R783L probably benign Het
Lrrk2 T G 15: 91,687,592 (GRCm39) I2227S probably benign Het
Lvrn T C 18: 47,013,803 (GRCm39) L495P probably damaging Het
Macf1 T C 4: 123,391,548 (GRCm39) N1077S probably damaging Het
Mboat1 A G 13: 30,425,213 (GRCm39) T425A probably damaging Het
Mcam A G 9: 44,047,863 (GRCm39) E36G probably damaging Het
Meis1 T A 11: 18,966,308 (GRCm39) T22S probably benign Het
Micu1 A G 10: 59,699,076 (GRCm39) K451R possibly damaging Het
Nat8 A T 6: 85,807,505 (GRCm39) D209E probably benign Het
Nek10 T A 14: 14,860,986 (GRCm38) L513M possibly damaging Het
Nmral1 G A 16: 4,534,274 (GRCm39) R56* probably null Het
Ofcc1 G A 13: 40,168,864 (GRCm39) T841I probably damaging Het
Or10j27 A G 1: 172,958,526 (GRCm39) V86A probably benign Het
Or5b99 A T 19: 12,977,195 (GRCm39) T282S probably benign Het
Or5g25 T C 2: 85,477,916 (GRCm39) I250V probably benign Het
Or5h24 G A 16: 58,919,340 (GRCm39) T5I probably damaging Het
Palm3 A T 8: 84,753,708 (GRCm39) R132* probably null Het
Pax2 A G 19: 44,804,479 (GRCm39) Y272C probably damaging Het
Phc2 G A 4: 128,616,908 (GRCm39) A394T probably benign Het
Phf2 C A 13: 48,961,198 (GRCm39) G831C unknown Het
Plin2 T A 4: 86,580,228 (GRCm39) I178F probably benign Het
Pramel32 A T 4: 88,547,185 (GRCm39) L162H probably damaging Het
Prdm14 T A 1: 13,192,855 (GRCm39) I295F probably damaging Het
Psmd5 C T 2: 34,760,795 (GRCm39) R47H probably benign Het
Ptchd3 T A 11: 121,733,342 (GRCm39) I744K probably damaging Het
Ptrh1 T A 2: 32,666,557 (GRCm39) probably benign Het
Rab6a A G 7: 100,277,627 (GRCm39) D49G probably damaging Het
Radil A T 5: 142,470,994 (GRCm39) D1062E probably benign Het
Robo2 A G 16: 74,149,726 (GRCm39) V34A possibly damaging Het
Sall3 G A 18: 81,014,626 (GRCm39) P1029S probably benign Het
Sec14l3 A G 11: 4,018,101 (GRCm39) D127G possibly damaging Het
Sel1l2 A G 2: 140,086,086 (GRCm39) Y502H probably damaging Het
Serpina1f A G 12: 103,656,010 (GRCm39) V406A probably damaging Het
Sf3b3 T C 8: 111,540,301 (GRCm39) D1040G probably damaging Het
Sgcd A G 11: 46,870,262 (GRCm39) I233T possibly damaging Het
Slc15a3 A G 19: 10,820,410 (GRCm39) Q9R probably benign Het
Slc25a46 A G 18: 31,716,336 (GRCm39) F389L probably damaging Het
Slc26a2 G T 18: 61,331,330 (GRCm39) C700* probably null Het
Slc4a7 A G 14: 14,771,283 (GRCm38) Y671C possibly damaging Het
Slc5a10 A T 11: 61,610,708 (GRCm39) I22N probably damaging Het
Slc5a9 C A 4: 111,748,941 (GRCm39) probably null Het
Slc6a12 A G 6: 121,332,281 (GRCm39) D205G probably benign Het
Tas2r115 G A 6: 132,714,124 (GRCm39) H276Y probably damaging Het
Tdpoz4 T A 3: 93,704,318 (GRCm39) I205N probably damaging Het
Tfeb C T 17: 48,096,904 (GRCm39) T33I probably benign Het
Tgm3 A G 2: 129,890,240 (GRCm39) T668A probably benign Het
Tnpo3 A G 6: 29,582,259 (GRCm39) V201A probably benign Het
Tpcn1 T A 5: 120,694,596 (GRCm39) M158L probably benign Het
Trim47 A C 11: 115,996,918 (GRCm39) L612R probably damaging Het
Trmt10c A T 16: 55,854,438 (GRCm39) L399* probably null Het
Trpm2 A T 10: 77,753,626 (GRCm39) S1293T probably benign Het
Ttn C T 2: 76,582,941 (GRCm39) V22651I probably damaging Het
Tubgcp5 A G 7: 55,455,871 (GRCm39) I300V probably benign Het
Uty T A Y: 1,136,883 (GRCm39) Q844L probably damaging Het
Vmn2r85 C T 10: 130,254,990 (GRCm39) E565K probably damaging Het
Vmn2r97 T C 17: 19,167,561 (GRCm39) V605A possibly damaging Het
Vwa3a T C 7: 120,375,487 (GRCm39) V399A probably damaging Het
Wnk4 G A 11: 101,159,107 (GRCm39) R508Q probably damaging Het
Zfp217 A G 2: 169,961,130 (GRCm39) V399A probably damaging Het
Zfp616 T A 11: 73,974,830 (GRCm39) N457K possibly damaging Het
Other mutations in Pik3c2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Pik3c2b APN 1 133,019,356 (GRCm39) missense probably damaging 0.98
IGL01288:Pik3c2b APN 1 133,022,543 (GRCm39) missense probably damaging 0.96
IGL01313:Pik3c2b APN 1 132,999,369 (GRCm39) nonsense probably null
IGL01367:Pik3c2b APN 1 133,033,726 (GRCm39) missense probably benign 0.02
IGL02379:Pik3c2b APN 1 133,022,529 (GRCm39) missense probably damaging 1.00
IGL02638:Pik3c2b APN 1 133,005,056 (GRCm39) splice site probably benign
IGL02728:Pik3c2b APN 1 133,020,065 (GRCm39) missense probably benign 0.09
IGL02992:Pik3c2b APN 1 132,994,718 (GRCm39) nonsense probably null
IGL03121:Pik3c2b APN 1 133,007,483 (GRCm39) missense probably benign 0.00
R0453:Pik3c2b UTSW 1 133,005,134 (GRCm39) missense probably damaging 1.00
R0518:Pik3c2b UTSW 1 133,033,730 (GRCm39) missense probably damaging 1.00
R0616:Pik3c2b UTSW 1 133,028,569 (GRCm39) missense probably damaging 1.00
R0659:Pik3c2b UTSW 1 132,998,938 (GRCm39) missense probably damaging 0.99
R1542:Pik3c2b UTSW 1 133,017,772 (GRCm39) missense probably damaging 1.00
R1716:Pik3c2b UTSW 1 133,022,564 (GRCm39) missense probably damaging 1.00
R1728:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1729:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1730:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1739:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1762:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1783:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1784:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1785:Pik3c2b UTSW 1 132,994,365 (GRCm39) missense probably benign 0.00
R1816:Pik3c2b UTSW 1 133,029,108 (GRCm39) missense probably benign 0.00
R1897:Pik3c2b UTSW 1 132,994,654 (GRCm39) missense possibly damaging 0.57
R2006:Pik3c2b UTSW 1 132,994,282 (GRCm39) missense probably damaging 1.00
R2067:Pik3c2b UTSW 1 133,027,349 (GRCm39) missense probably damaging 1.00
R2271:Pik3c2b UTSW 1 133,031,166 (GRCm39) missense probably benign
R2294:Pik3c2b UTSW 1 132,994,513 (GRCm39) missense probably damaging 1.00
R2320:Pik3c2b UTSW 1 133,031,151 (GRCm39) missense probably damaging 1.00
R4735:Pik3c2b UTSW 1 132,994,787 (GRCm39) missense probably benign 0.25
R4926:Pik3c2b UTSW 1 133,027,364 (GRCm39) nonsense probably null
R4997:Pik3c2b UTSW 1 133,032,819 (GRCm39) missense probably damaging 1.00
R5304:Pik3c2b UTSW 1 132,998,146 (GRCm39) missense possibly damaging 0.50
R5461:Pik3c2b UTSW 1 133,027,440 (GRCm39) missense possibly damaging 0.66
R5722:Pik3c2b UTSW 1 133,031,574 (GRCm39) missense probably damaging 1.00
R5971:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R5980:Pik3c2b UTSW 1 133,016,046 (GRCm39) missense probably benign 0.43
R6036:Pik3c2b UTSW 1 133,018,451 (GRCm39) missense possibly damaging 0.95
R6138:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
R6223:Pik3c2b UTSW 1 132,998,095 (GRCm39) missense probably damaging 1.00
R6273:Pik3c2b UTSW 1 132,994,449 (GRCm39) missense probably benign 0.02
R6742:Pik3c2b UTSW 1 133,003,559 (GRCm39) missense probably benign
R6954:Pik3c2b UTSW 1 132,994,041 (GRCm39) missense possibly damaging 0.50
R6998:Pik3c2b UTSW 1 133,030,110 (GRCm39) missense probably benign 0.23
R7103:Pik3c2b UTSW 1 133,033,712 (GRCm39) missense probably damaging 1.00
R7133:Pik3c2b UTSW 1 133,017,972 (GRCm39) missense possibly damaging 0.73
R7161:Pik3c2b UTSW 1 133,033,850 (GRCm39) missense probably damaging 0.98
R7183:Pik3c2b UTSW 1 132,994,203 (GRCm39) missense probably benign 0.00
R7193:Pik3c2b UTSW 1 133,007,512 (GRCm39) missense probably benign 0.00
R7252:Pik3c2b UTSW 1 133,022,472 (GRCm39) missense probably benign 0.19
R7263:Pik3c2b UTSW 1 133,017,940 (GRCm39) missense probably damaging 0.98
R7404:Pik3c2b UTSW 1 133,018,444 (GRCm39) missense probably damaging 1.00
R7709:Pik3c2b UTSW 1 133,007,579 (GRCm39) critical splice donor site probably null
R7712:Pik3c2b UTSW 1 133,013,349 (GRCm39) missense probably damaging 1.00
R7823:Pik3c2b UTSW 1 133,030,043 (GRCm39) missense probably damaging 1.00
R7831:Pik3c2b UTSW 1 132,998,980 (GRCm39) missense possibly damaging 0.94
R7913:Pik3c2b UTSW 1 133,017,799 (GRCm39) critical splice donor site probably null
R7916:Pik3c2b UTSW 1 133,028,642 (GRCm39) missense probably benign 0.30
R7960:Pik3c2b UTSW 1 133,031,587 (GRCm39) missense probably damaging 1.00
R7981:Pik3c2b UTSW 1 133,003,547 (GRCm39) critical splice acceptor site probably null
R8346:Pik3c2b UTSW 1 133,017,984 (GRCm39) missense probably damaging 0.97
R8938:Pik3c2b UTSW 1 133,016,068 (GRCm39) missense probably benign 0.19
R8997:Pik3c2b UTSW 1 133,018,517 (GRCm39) missense possibly damaging 0.83
R9416:Pik3c2b UTSW 1 133,005,187 (GRCm39) missense probably damaging 1.00
R9598:Pik3c2b UTSW 1 133,012,725 (GRCm39) critical splice donor site probably null
R9621:Pik3c2b UTSW 1 132,999,345 (GRCm39) missense probably damaging 1.00
R9742:Pik3c2b UTSW 1 133,022,487 (GRCm39) missense probably damaging 1.00
R9776:Pik3c2b UTSW 1 133,018,588 (GRCm39) missense possibly damaging 0.64
R9786:Pik3c2b UTSW 1 133,019,338 (GRCm39) missense possibly damaging 0.94
U15987:Pik3c2b UTSW 1 133,002,365 (GRCm39) splice site probably null
X0060:Pik3c2b UTSW 1 133,012,674 (GRCm39) missense probably benign 0.18
Z1176:Pik3c2b UTSW 1 133,027,424 (GRCm39) nonsense probably null
Z1176:Pik3c2b UTSW 1 132,994,291 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCTATAACCCCAATCAGG -3'
(R):5'- ATACATATTGGCCTCAGAATGCAG -3'

Sequencing Primer
(F):5'- TTGTATAGAAAACCCTGGCCTACGG -3'
(R):5'- TATTGGCCTCAGAATGCAGACAGG -3'
Posted On 2016-04-27