Incidental Mutation 'R4948:Cpz'
ID383567
Institutional Source Beutler Lab
Gene Symbol Cpz
Ensembl Gene ENSMUSG00000036596
Gene Namecarboxypeptidase Z
Synonyms
MMRRC Submission 042545-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.374) question?
Stock #R4948 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location35502218-35525698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35517404 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 167 (E167G)
Ref Sequence ENSEMBL: ENSMUSP00000039804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038676] [ENSMUST00000132959]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038676
AA Change: E167G

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000039804
Gene: ENSMUSG00000036596
AA Change: E167G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 35 N/A INTRINSIC
FRI 47 167 7.02e-38 SMART
low complexity region 300 313 N/A INTRINSIC
Zn_pept 314 626 1.32e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132959
SMART Domains Protein: ENSMUSP00000123537
Gene: ENSMUSG00000036596

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 23 34 N/A INTRINSIC
Pfam:Fz 37 102 4.7e-9 PFAM
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallocarboxypeptidase family. This enzyme displays carboxypeptidase activity towards substrates with basic C-terminal residues. It is most active at neutral pH and is inhibited by active site-directed inhibitors of metallocarboxypeptidases. Alternative splicing in the coding region results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,290 probably null Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Alas1 A T 9: 106,246,878 L27* probably null Het
Aldh1a7 A G 19: 20,727,010 V40A possibly damaging Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
B3gnt5 A C 16: 19,769,144 M38L probably benign Het
Brd8 A G 18: 34,614,532 V92A probably damaging Het
Btla A T 16: 45,242,728 E151D probably benign Het
C87499 A T 4: 88,628,948 L162H probably damaging Het
Cd79b T A 11: 106,312,861 T67S probably benign Het
Cep192 A G 18: 67,816,804 R320G probably benign Het
Chad A C 11: 94,565,702 D202A probably damaging Het
Chil6 A G 3: 106,388,672 probably benign Het
Crisp2 T G 17: 40,765,268 H225P probably damaging Het
Cyp2c23 T C 19: 44,021,699 Y69C possibly damaging Het
Dcp1a T A 14: 30,479,767 L49H probably damaging Het
Dnah6 T A 6: 73,053,689 H3380L probably benign Het
Dnm2 A G 9: 21,504,533 D721G possibly damaging Het
Dnpep G T 1: 75,316,760 T15K probably benign Het
Dock3 A T 9: 106,991,155 D643E probably damaging Het
Ear6 C T 14: 51,854,116 T40I possibly damaging Het
Fancm A G 12: 65,090,974 D313G probably damaging Het
Fbxw16 T A 9: 109,438,347 E272V probably damaging Het
Frmd4b T A 6: 97,306,730 E393D probably benign Het
Fryl T A 5: 73,089,130 M1100L probably benign Het
Gjc1 T C 11: 102,800,421 H252R probably damaging Het
Gm10518 T C 1: 179,803,912 probably benign Het
Gna14 A G 19: 16,603,292 M165V probably benign Het
Hells C A 19: 38,935,522 Q72K probably damaging Het
Herc1 A G 9: 66,484,902 I4031V probably benign Het
Hspa2 C T 12: 76,405,987 A485V probably damaging Het
Ighv1-54 T A 12: 115,193,818 I70F probably benign Het
Il20rb A T 9: 100,461,539 probably benign Het
Krt1 C A 15: 101,845,941 V625L unknown Het
Lamc3 T C 2: 31,940,736 I1495T probably benign Het
Larp6 A G 9: 60,737,780 E401G possibly damaging Het
Ldha A T 7: 46,847,381 H19L probably benign Het
Lrba A G 3: 86,285,028 N83S probably damaging Het
Lrp4 G T 2: 91,485,886 R783L probably benign Het
Lrrk2 T G 15: 91,803,389 I2227S probably benign Het
Lvrn T C 18: 46,880,736 L495P probably damaging Het
Macf1 T C 4: 123,497,755 N1077S probably damaging Het
Mboat1 A G 13: 30,241,230 T425A probably damaging Het
Mcam A G 9: 44,136,566 E36G probably damaging Het
Meis1 T A 11: 19,016,308 T22S probably benign Het
Micu1 A G 10: 59,863,254 K451R possibly damaging Het
Mrvi1 A G 7: 110,888,029 V498A probably damaging Het
Nat8 A T 6: 85,830,523 D209E probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nmral1 G A 16: 4,716,410 R56* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1002 T C 2: 85,647,572 I250V probably benign Het
Olfr1408 A G 1: 173,130,959 V86A probably benign Het
Olfr1451 A T 19: 12,999,831 T282S probably benign Het
Olfr192 G A 16: 59,098,977 T5I probably damaging Het
Palm3 A T 8: 84,027,079 R132* probably null Het
Pax2 A G 19: 44,816,040 Y272C probably damaging Het
Phc2 G A 4: 128,723,115 A394T probably benign Het
Phf2 C A 13: 48,807,722 G831C unknown Het
Pik3c2b G A 1: 133,099,715 probably null Het
Plin2 T A 4: 86,661,991 I178F probably benign Het
Prdm14 T A 1: 13,122,631 I295F probably damaging Het
Psmd5 C T 2: 34,870,783 R47H probably benign Het
Ptchd3 T A 11: 121,842,516 I744K probably damaging Het
Ptrh1 T A 2: 32,776,545 probably benign Het
Rab6a A G 7: 100,628,420 D49G probably damaging Het
Radil A T 5: 142,485,239 D1062E probably benign Het
Robo2 A G 16: 74,352,838 V34A possibly damaging Het
Sall3 G A 18: 80,971,411 P1029S probably benign Het
Sec14l3 A G 11: 4,068,101 D127G possibly damaging Het
Sel1l2 A G 2: 140,244,166 Y502H probably damaging Het
Serpina1f A G 12: 103,689,751 V406A probably damaging Het
Sf3b3 T C 8: 110,813,669 D1040G probably damaging Het
Sgcd A G 11: 46,979,435 I233T possibly damaging Het
Slc15a3 A G 19: 10,843,046 Q9R probably benign Het
Slc25a46 A G 18: 31,583,283 F389L probably damaging Het
Slc26a2 G T 18: 61,198,258 C700* probably null Het
Slc4a7 A G 14: 14,771,283 Y671C possibly damaging Het
Slc5a10 A T 11: 61,719,882 I22N probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc6a12 A G 6: 121,355,322 D205G probably benign Het
Tas2r115 G A 6: 132,737,161 H276Y probably damaging Het
Tdpoz4 T A 3: 93,797,011 I205N probably damaging Het
Tfeb C T 17: 47,785,979 T33I probably benign Het
Tgm3 A G 2: 130,048,320 T668A probably benign Het
Tnpo3 A G 6: 29,582,260 V201A probably benign Het
Tpcn1 T A 5: 120,556,531 M158L probably benign Het
Trim47 A C 11: 116,106,092 L612R probably damaging Het
Trmt10c A T 16: 56,034,075 L399* probably null Het
Trpm2 A T 10: 77,917,792 S1293T probably benign Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Tubgcp5 A G 7: 55,806,123 I300V probably benign Het
Uty T A Y: 1,136,883 Q844L probably damaging Het
Vmn2r85 C T 10: 130,419,121 E565K probably damaging Het
Vmn2r97 T C 17: 18,947,299 V605A possibly damaging Het
Vwa3a T C 7: 120,776,264 V399A probably damaging Het
Wdr63 T A 3: 146,083,065 K254* probably null Het
Wnk4 G A 11: 101,268,281 R508Q probably damaging Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp616 T A 11: 74,084,004 N457K possibly damaging Het
Other mutations in Cpz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01673:Cpz APN 5 35512547 missense probably benign
IGL02182:Cpz APN 5 35517722 missense probably damaging 1.00
IGL02290:Cpz APN 5 35511142 missense probably benign 0.00
IGL02632:Cpz APN 5 35511811 missense possibly damaging 0.95
PIT4810001:Cpz UTSW 5 35508192 missense possibly damaging 0.96
R0334:Cpz UTSW 5 35503681 missense probably damaging 0.99
R0918:Cpz UTSW 5 35517654 missense probably damaging 1.00
R1664:Cpz UTSW 5 35506743 missense probably damaging 1.00
R1666:Cpz UTSW 5 35508116 critical splice donor site probably null
R1733:Cpz UTSW 5 35517758 missense probably damaging 1.00
R1851:Cpz UTSW 5 35502558 missense possibly damaging 0.90
R1920:Cpz UTSW 5 35517668 missense probably damaging 1.00
R1943:Cpz UTSW 5 35512428 missense probably damaging 1.00
R2866:Cpz UTSW 5 35502361 missense probably benign 0.09
R2867:Cpz UTSW 5 35502361 missense probably benign 0.09
R2867:Cpz UTSW 5 35502361 missense probably benign 0.09
R2892:Cpz UTSW 5 35511129 missense probably damaging 1.00
R3795:Cpz UTSW 5 35511749 missense probably benign
R4238:Cpz UTSW 5 35502474 missense probably benign 0.04
R4886:Cpz UTSW 5 35506704 missense probably damaging 1.00
R5936:Cpz UTSW 5 35502643 missense probably benign 0.00
R6023:Cpz UTSW 5 35512578 missense probably benign 0.34
R6035:Cpz UTSW 5 35517585 missense probably damaging 1.00
R6035:Cpz UTSW 5 35517585 missense probably damaging 1.00
R7346:Cpz UTSW 5 35517656 missense probably damaging 1.00
R7431:Cpz UTSW 5 35511142 missense probably benign 0.00
R7620:Cpz UTSW 5 35511850 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TAGGATCCTTCGTGTGCATG -3'
(R):5'- ATACACTTTCTCCTGGAGGGTC -3'

Sequencing Primer
(F):5'- ATCCTTCGTGTGCATGGATGG -3'
(R):5'- TCAGTGCAACCCTGACCTG -3'
Posted On2016-04-27