Incidental Mutation 'R4948:Dnm2'
ID383584
Institutional Source Beutler Lab
Gene Symbol Dnm2
Ensembl Gene ENSMUSG00000033335
Gene Namedynamin 2
Synonymsb2b2159Clo, Dyn2
MMRRC Submission 042545-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4948 (G1)
Quality Score223
Status Validated
Chromosome9
Chromosomal Location21424908-21507759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21504533 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 721 (D721G)
Ref Sequence ENSEMBL: ENSMUSP00000133564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034698] [ENSMUST00000072362] [ENSMUST00000091087] [ENSMUST00000115404] [ENSMUST00000165766] [ENSMUST00000172482] [ENSMUST00000173397] [ENSMUST00000214285] [ENSMUST00000214576]
Predicted Effect probably benign
Transcript: ENSMUST00000034698
SMART Domains Protein: ENSMUSP00000034698
Gene: ENSMUSG00000032180

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
EMP24_GP25L 33 220 1.78e-54 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000072362
AA Change: D721G

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335
AA Change: D721G

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000091087
AA Change: D717G

PolyPhen 2 Score 0.271 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335
AA Change: D717G

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115404
AA Change: D721G

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335
AA Change: D721G

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165766
AA Change: D721G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335
AA Change: D721G

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172482
AA Change: D721G

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335
AA Change: D721G

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173299
Predicted Effect probably benign
Transcript: ENSMUST00000173397
AA Change: D721G

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335
AA Change: D721G

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174050
AA Change: D667G

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335
AA Change: D667G

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174243
Predicted Effect probably benign
Transcript: ENSMUST00000213167
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213316
Predicted Effect probably benign
Transcript: ENSMUST00000214285
Predicted Effect probably benign
Transcript: ENSMUST00000214576
Meta Mutation Damage Score 0.3069 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele die prior to E8-E12. Mice heterozygous for a knock-out allele exhibit muscle atrophy and weakness, intermyofibrillar disorganization, and centrally localized mitochondria and sarcoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,290 probably null Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Alas1 A T 9: 106,246,878 L27* probably null Het
Aldh1a7 A G 19: 20,727,010 V40A possibly damaging Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
B3gnt5 A C 16: 19,769,144 M38L probably benign Het
Brd8 A G 18: 34,614,532 V92A probably damaging Het
Btla A T 16: 45,242,728 E151D probably benign Het
C87499 A T 4: 88,628,948 L162H probably damaging Het
Cd79b T A 11: 106,312,861 T67S probably benign Het
Cep192 A G 18: 67,816,804 R320G probably benign Het
Chad A C 11: 94,565,702 D202A probably damaging Het
Chil6 A G 3: 106,388,672 probably benign Het
Cpz T C 5: 35,517,404 E167G possibly damaging Het
Crisp2 T G 17: 40,765,268 H225P probably damaging Het
Cyp2c23 T C 19: 44,021,699 Y69C possibly damaging Het
Dcp1a T A 14: 30,479,767 L49H probably damaging Het
Dnah6 T A 6: 73,053,689 H3380L probably benign Het
Dnpep G T 1: 75,316,760 T15K probably benign Het
Dock3 A T 9: 106,991,155 D643E probably damaging Het
Ear6 C T 14: 51,854,116 T40I possibly damaging Het
Fancm A G 12: 65,090,974 D313G probably damaging Het
Fbxw16 T A 9: 109,438,347 E272V probably damaging Het
Frmd4b T A 6: 97,306,730 E393D probably benign Het
Fryl T A 5: 73,089,130 M1100L probably benign Het
Gjc1 T C 11: 102,800,421 H252R probably damaging Het
Gm10518 T C 1: 179,803,912 probably benign Het
Gna14 A G 19: 16,603,292 M165V probably benign Het
Hells C A 19: 38,935,522 Q72K probably damaging Het
Herc1 A G 9: 66,484,902 I4031V probably benign Het
Hspa2 C T 12: 76,405,987 A485V probably damaging Het
Ighv1-54 T A 12: 115,193,818 I70F probably benign Het
Il20rb A T 9: 100,461,539 probably benign Het
Krt1 C A 15: 101,845,941 V625L unknown Het
Lamc3 T C 2: 31,940,736 I1495T probably benign Het
Larp6 A G 9: 60,737,780 E401G possibly damaging Het
Ldha A T 7: 46,847,381 H19L probably benign Het
Lrba A G 3: 86,285,028 N83S probably damaging Het
Lrp4 G T 2: 91,485,886 R783L probably benign Het
Lrrk2 T G 15: 91,803,389 I2227S probably benign Het
Lvrn T C 18: 46,880,736 L495P probably damaging Het
Macf1 T C 4: 123,497,755 N1077S probably damaging Het
Mboat1 A G 13: 30,241,230 T425A probably damaging Het
Mcam A G 9: 44,136,566 E36G probably damaging Het
Meis1 T A 11: 19,016,308 T22S probably benign Het
Micu1 A G 10: 59,863,254 K451R possibly damaging Het
Mrvi1 A G 7: 110,888,029 V498A probably damaging Het
Nat8 A T 6: 85,830,523 D209E probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nmral1 G A 16: 4,716,410 R56* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1002 T C 2: 85,647,572 I250V probably benign Het
Olfr1408 A G 1: 173,130,959 V86A probably benign Het
Olfr1451 A T 19: 12,999,831 T282S probably benign Het
Olfr192 G A 16: 59,098,977 T5I probably damaging Het
Palm3 A T 8: 84,027,079 R132* probably null Het
Pax2 A G 19: 44,816,040 Y272C probably damaging Het
Phc2 G A 4: 128,723,115 A394T probably benign Het
Phf2 C A 13: 48,807,722 G831C unknown Het
Pik3c2b G A 1: 133,099,715 probably null Het
Plin2 T A 4: 86,661,991 I178F probably benign Het
Prdm14 T A 1: 13,122,631 I295F probably damaging Het
Psmd5 C T 2: 34,870,783 R47H probably benign Het
Ptchd3 T A 11: 121,842,516 I744K probably damaging Het
Ptrh1 T A 2: 32,776,545 probably benign Het
Rab6a A G 7: 100,628,420 D49G probably damaging Het
Radil A T 5: 142,485,239 D1062E probably benign Het
Robo2 A G 16: 74,352,838 V34A possibly damaging Het
Sall3 G A 18: 80,971,411 P1029S probably benign Het
Sec14l3 A G 11: 4,068,101 D127G possibly damaging Het
Sel1l2 A G 2: 140,244,166 Y502H probably damaging Het
Serpina1f A G 12: 103,689,751 V406A probably damaging Het
Sf3b3 T C 8: 110,813,669 D1040G probably damaging Het
Sgcd A G 11: 46,979,435 I233T possibly damaging Het
Slc15a3 A G 19: 10,843,046 Q9R probably benign Het
Slc25a46 A G 18: 31,583,283 F389L probably damaging Het
Slc26a2 G T 18: 61,198,258 C700* probably null Het
Slc4a7 A G 14: 14,771,283 Y671C possibly damaging Het
Slc5a10 A T 11: 61,719,882 I22N probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc6a12 A G 6: 121,355,322 D205G probably benign Het
Tas2r115 G A 6: 132,737,161 H276Y probably damaging Het
Tdpoz4 T A 3: 93,797,011 I205N probably damaging Het
Tfeb C T 17: 47,785,979 T33I probably benign Het
Tgm3 A G 2: 130,048,320 T668A probably benign Het
Tnpo3 A G 6: 29,582,260 V201A probably benign Het
Tpcn1 T A 5: 120,556,531 M158L probably benign Het
Trim47 A C 11: 116,106,092 L612R probably damaging Het
Trmt10c A T 16: 56,034,075 L399* probably null Het
Trpm2 A T 10: 77,917,792 S1293T probably benign Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Tubgcp5 A G 7: 55,806,123 I300V probably benign Het
Uty T A Y: 1,136,883 Q844L probably damaging Het
Vmn2r85 C T 10: 130,419,121 E565K probably damaging Het
Vmn2r97 T C 17: 18,947,299 V605A possibly damaging Het
Vwa3a T C 7: 120,776,264 V399A probably damaging Het
Wdr63 T A 3: 146,083,065 K254* probably null Het
Wnk4 G A 11: 101,268,281 R508Q probably damaging Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp616 T A 11: 74,084,004 N457K possibly damaging Het
Other mutations in Dnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Dnm2 APN 9 21481376 missense probably damaging 1.00
IGL01757:Dnm2 APN 9 21465619 missense probably damaging 1.00
IGL02142:Dnm2 APN 9 21500353 missense probably damaging 1.00
IGL02195:Dnm2 APN 9 21425249 missense probably damaging 1.00
IGL02472:Dnm2 APN 9 21485708 missense possibly damaging 0.55
IGL03161:Dnm2 APN 9 21485724 splice site probably benign
IGL03392:Dnm2 APN 9 21474611 missense probably damaging 1.00
R0302:Dnm2 UTSW 9 21500343 missense probably benign 0.27
R0743:Dnm2 UTSW 9 21500265 missense probably damaging 1.00
R0945:Dnm2 UTSW 9 21505660 missense probably damaging 0.97
R1629:Dnm2 UTSW 9 21504458 missense probably damaging 1.00
R1678:Dnm2 UTSW 9 21467532 missense possibly damaging 0.89
R1848:Dnm2 UTSW 9 21505681 missense possibly damaging 0.87
R2084:Dnm2 UTSW 9 21500371 critical splice donor site probably null
R2214:Dnm2 UTSW 9 21485723 critical splice donor site probably null
R2346:Dnm2 UTSW 9 21467556 missense probably damaging 1.00
R3711:Dnm2 UTSW 9 21506373 unclassified probably benign
R3796:Dnm2 UTSW 9 21505487 missense probably benign
R4017:Dnm2 UTSW 9 21494604 missense probably damaging 1.00
R4432:Dnm2 UTSW 9 21491304 intron probably benign
R4583:Dnm2 UTSW 9 21504446 missense probably damaging 1.00
R4604:Dnm2 UTSW 9 21504664 critical splice donor site probably null
R4735:Dnm2 UTSW 9 21474587 missense probably damaging 0.99
R4803:Dnm2 UTSW 9 21474629 missense probably damaging 1.00
R4832:Dnm2 UTSW 9 21474679 splice site probably null
R4836:Dnm2 UTSW 9 21491330 intron probably benign
R4937:Dnm2 UTSW 9 21481337 missense probably benign 0.00
R5059:Dnm2 UTSW 9 21504578 missense probably damaging 1.00
R5291:Dnm2 UTSW 9 21478907 missense probably damaging 1.00
R5538:Dnm2 UTSW 9 21505627 missense probably benign 0.05
R5613:Dnm2 UTSW 9 21472667 missense probably damaging 1.00
R5805:Dnm2 UTSW 9 21467669 missense probably damaging 0.97
R6253:Dnm2 UTSW 9 21500275 missense probably damaging 1.00
R6586:Dnm2 UTSW 9 21505646 missense probably benign 0.32
R6826:Dnm2 UTSW 9 21504471 nonsense probably null
R6855:Dnm2 UTSW 9 21476585 missense probably damaging 1.00
R7121:Dnm2 UTSW 9 21474566 missense probably benign 0.31
R7307:Dnm2 UTSW 9 21485687 missense probably damaging 1.00
R7318:Dnm2 UTSW 9 21505567 missense possibly damaging 0.46
R7467:Dnm2 UTSW 9 21481376 missense probably damaging 1.00
R7619:Dnm2 UTSW 9 21505634 missense probably benign 0.00
R7673:Dnm2 UTSW 9 21481421 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCAATCTCAACAGGCTTCTG -3'
(R):5'- TTTCCAAACTTCAGCTGTGAAC -3'

Sequencing Primer
(F):5'- CTCAACAGGCTTCTGAGTTATTGGC -3'
(R):5'- GCTGTGAACTATTTCCTAATGGGAC -3'
Posted On2016-04-27