Incidental Mutation 'R4948:Dock3'
ID383589
Institutional Source Beutler Lab
Gene Symbol Dock3
Ensembl Gene ENSMUSG00000039716
Gene Namededicator of cyto-kinesis 3
SynonymsPBP, Moca
MMRRC Submission 042545-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #R4948 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106892825-107231909 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106991155 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 643 (D643E)
Ref Sequence ENSEMBL: ENSMUSP00000047652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044532]
Predicted Effect probably damaging
Transcript: ENSMUST00000044532
AA Change: D643E

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047652
Gene: ENSMUSG00000039716
AA Change: D643E

DomainStartEndE-ValueType
SH3 9 66 3.85e-9 SMART
Pfam:DOCK_N 69 412 1.4e-120 PFAM
Pfam:DOCK-C2 417 608 7.7e-56 PFAM
low complexity region 854 867 N/A INTRINSIC
low complexity region 892 916 N/A INTRINSIC
Pfam:DHR-2 1121 1628 9e-133 PFAM
low complexity region 1679 1690 N/A INTRINSIC
low complexity region 1693 1704 N/A INTRINSIC
low complexity region 1730 1754 N/A INTRINSIC
low complexity region 1880 1902 N/A INTRINSIC
low complexity region 1963 1977 N/A INTRINSIC
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is specifically expressed in the central nervous system (CNS). It encodes a member of the DOCK (dedicator of cytokinesis) family of guanine nucleotide exchange factors (GEFs). This protein, dedicator of cytokinesis 3 (DOCK3), is also known as modifier of cell adhesion (MOCA) and presenilin-binding protein (PBP). The DOCK3 and DOCK1, -2 and -4 share several conserved amino acids in their DHR-2 (DOCK homology region 2) domains that are required for GEF activity, and bind directly to WAVE proteins [Wiskott-Aldrich syndrome protein (WASP) family Verprolin-homologous proteins] via their DHR-1 domains. The DOCK3 induces axonal outgrowth in CNS by stimulating membrane recruitment of the WAVE complex and activating the small G protein Rac1. This gene is associated with an attention deficit hyperactivity disorder-like phenotype by a complex chromosomal rearrangement. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal behaviors and muscular weakness associated with axonal dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,290 probably null Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Alas1 A T 9: 106,246,878 L27* probably null Het
Aldh1a7 A G 19: 20,727,010 V40A possibly damaging Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
B3gnt5 A C 16: 19,769,144 M38L probably benign Het
Brd8 A G 18: 34,614,532 V92A probably damaging Het
Btla A T 16: 45,242,728 E151D probably benign Het
C87499 A T 4: 88,628,948 L162H probably damaging Het
Cd79b T A 11: 106,312,861 T67S probably benign Het
Cep192 A G 18: 67,816,804 R320G probably benign Het
Chad A C 11: 94,565,702 D202A probably damaging Het
Chil6 A G 3: 106,388,672 probably benign Het
Cpz T C 5: 35,517,404 E167G possibly damaging Het
Crisp2 T G 17: 40,765,268 H225P probably damaging Het
Cyp2c23 T C 19: 44,021,699 Y69C possibly damaging Het
Dcp1a T A 14: 30,479,767 L49H probably damaging Het
Dnah6 T A 6: 73,053,689 H3380L probably benign Het
Dnm2 A G 9: 21,504,533 D721G possibly damaging Het
Dnpep G T 1: 75,316,760 T15K probably benign Het
Ear6 C T 14: 51,854,116 T40I possibly damaging Het
Fancm A G 12: 65,090,974 D313G probably damaging Het
Fbxw16 T A 9: 109,438,347 E272V probably damaging Het
Frmd4b T A 6: 97,306,730 E393D probably benign Het
Fryl T A 5: 73,089,130 M1100L probably benign Het
Gjc1 T C 11: 102,800,421 H252R probably damaging Het
Gm10518 T C 1: 179,803,912 probably benign Het
Gna14 A G 19: 16,603,292 M165V probably benign Het
Hells C A 19: 38,935,522 Q72K probably damaging Het
Herc1 A G 9: 66,484,902 I4031V probably benign Het
Hspa2 C T 12: 76,405,987 A485V probably damaging Het
Ighv1-54 T A 12: 115,193,818 I70F probably benign Het
Il20rb A T 9: 100,461,539 probably benign Het
Krt1 C A 15: 101,845,941 V625L unknown Het
Lamc3 T C 2: 31,940,736 I1495T probably benign Het
Larp6 A G 9: 60,737,780 E401G possibly damaging Het
Ldha A T 7: 46,847,381 H19L probably benign Het
Lrba A G 3: 86,285,028 N83S probably damaging Het
Lrp4 G T 2: 91,485,886 R783L probably benign Het
Lrrk2 T G 15: 91,803,389 I2227S probably benign Het
Lvrn T C 18: 46,880,736 L495P probably damaging Het
Macf1 T C 4: 123,497,755 N1077S probably damaging Het
Mboat1 A G 13: 30,241,230 T425A probably damaging Het
Mcam A G 9: 44,136,566 E36G probably damaging Het
Meis1 T A 11: 19,016,308 T22S probably benign Het
Micu1 A G 10: 59,863,254 K451R possibly damaging Het
Mrvi1 A G 7: 110,888,029 V498A probably damaging Het
Nat8 A T 6: 85,830,523 D209E probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nmral1 G A 16: 4,716,410 R56* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1002 T C 2: 85,647,572 I250V probably benign Het
Olfr1408 A G 1: 173,130,959 V86A probably benign Het
Olfr1451 A T 19: 12,999,831 T282S probably benign Het
Olfr192 G A 16: 59,098,977 T5I probably damaging Het
Palm3 A T 8: 84,027,079 R132* probably null Het
Pax2 A G 19: 44,816,040 Y272C probably damaging Het
Phc2 G A 4: 128,723,115 A394T probably benign Het
Phf2 C A 13: 48,807,722 G831C unknown Het
Pik3c2b G A 1: 133,099,715 probably null Het
Plin2 T A 4: 86,661,991 I178F probably benign Het
Prdm14 T A 1: 13,122,631 I295F probably damaging Het
Psmd5 C T 2: 34,870,783 R47H probably benign Het
Ptchd3 T A 11: 121,842,516 I744K probably damaging Het
Ptrh1 T A 2: 32,776,545 probably benign Het
Rab6a A G 7: 100,628,420 D49G probably damaging Het
Radil A T 5: 142,485,239 D1062E probably benign Het
Robo2 A G 16: 74,352,838 V34A possibly damaging Het
Sall3 G A 18: 80,971,411 P1029S probably benign Het
Sec14l3 A G 11: 4,068,101 D127G possibly damaging Het
Sel1l2 A G 2: 140,244,166 Y502H probably damaging Het
Serpina1f A G 12: 103,689,751 V406A probably damaging Het
Sf3b3 T C 8: 110,813,669 D1040G probably damaging Het
Sgcd A G 11: 46,979,435 I233T possibly damaging Het
Slc15a3 A G 19: 10,843,046 Q9R probably benign Het
Slc25a46 A G 18: 31,583,283 F389L probably damaging Het
Slc26a2 G T 18: 61,198,258 C700* probably null Het
Slc4a7 A G 14: 14,771,283 Y671C possibly damaging Het
Slc5a10 A T 11: 61,719,882 I22N probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc6a12 A G 6: 121,355,322 D205G probably benign Het
Tas2r115 G A 6: 132,737,161 H276Y probably damaging Het
Tdpoz4 T A 3: 93,797,011 I205N probably damaging Het
Tfeb C T 17: 47,785,979 T33I probably benign Het
Tgm3 A G 2: 130,048,320 T668A probably benign Het
Tnpo3 A G 6: 29,582,260 V201A probably benign Het
Tpcn1 T A 5: 120,556,531 M158L probably benign Het
Trim47 A C 11: 116,106,092 L612R probably damaging Het
Trmt10c A T 16: 56,034,075 L399* probably null Het
Trpm2 A T 10: 77,917,792 S1293T probably benign Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Tubgcp5 A G 7: 55,806,123 I300V probably benign Het
Uty T A Y: 1,136,883 Q844L probably damaging Het
Vmn2r85 C T 10: 130,419,121 E565K probably damaging Het
Vmn2r97 T C 17: 18,947,299 V605A possibly damaging Het
Vwa3a T C 7: 120,776,264 V399A probably damaging Het
Wdr63 T A 3: 146,083,065 K254* probably null Het
Wnk4 G A 11: 101,268,281 R508Q probably damaging Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp616 T A 11: 74,084,004 N457K possibly damaging Het
Other mutations in Dock3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Dock3 APN 9 106911377 splice site probably benign
IGL01067:Dock3 APN 9 107082373 critical splice donor site probably null
IGL01160:Dock3 APN 9 106906688 missense probably damaging 1.00
IGL01290:Dock3 APN 9 106958400 splice site probably benign
IGL01291:Dock3 APN 9 106958400 splice site probably benign
IGL01391:Dock3 APN 9 106907234 missense possibly damaging 0.55
IGL01399:Dock3 APN 9 106993471 missense probably benign 0.06
IGL01660:Dock3 APN 9 107032364 splice site probably benign
IGL01752:Dock3 APN 9 107025313 splice site probably benign
IGL01820:Dock3 APN 9 106895893 missense probably damaging 1.00
IGL01908:Dock3 APN 9 106906662 missense possibly damaging 0.81
IGL02191:Dock3 APN 9 106938141 missense probably benign
IGL02227:Dock3 APN 9 107062055 missense probably damaging 0.98
IGL02309:Dock3 APN 9 106913152 missense probably damaging 1.00
IGL02408:Dock3 APN 9 106913099 splice site probably benign
IGL02469:Dock3 APN 9 106986016 missense probably damaging 0.98
IGL02545:Dock3 APN 9 107062072 missense probably damaging 1.00
IGL02894:Dock3 APN 9 106930099 missense probably benign 0.00
IGL02934:Dock3 APN 9 107023745 missense probably benign 0.01
IGL03027:Dock3 APN 9 106993478 missense probably damaging 0.98
IGL03068:Dock3 APN 9 106964759 missense possibly damaging 0.82
IGL03128:Dock3 APN 9 107032292 missense probably benign 0.05
IGL03161:Dock3 APN 9 107023788 missense probably damaging 0.99
IGL03263:Dock3 APN 9 106930131 splice site probably benign
IGL03279:Dock3 APN 9 106911248 splice site probably benign
IGL03366:Dock3 APN 9 107005433 missense probably benign 0.01
Implosion UTSW 9 106937926 missense probably benign 0.00
squeeze UTSW 9 106930043 missense probably damaging 1.00
Tight UTSW 9 106994881 missense probably damaging 1.00
ANU05:Dock3 UTSW 9 106895663 missense probably benign
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0025:Dock3 UTSW 9 106913268 missense possibly damaging 0.90
R0030:Dock3 UTSW 9 106912313 missense possibly damaging 0.64
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0076:Dock3 UTSW 9 106911486 splice site probably benign
R0206:Dock3 UTSW 9 106996996 nonsense probably null
R0208:Dock3 UTSW 9 106996996 nonsense probably null
R0384:Dock3 UTSW 9 106901895 splice site probably benign
R0610:Dock3 UTSW 9 107023788 missense probably damaging 0.99
R0731:Dock3 UTSW 9 106969856 missense probably damaging 1.00
R1184:Dock3 UTSW 9 106969800 missense probably damaging 1.00
R1350:Dock3 UTSW 9 106914632 missense possibly damaging 0.52
R1393:Dock3 UTSW 9 106911349 missense probably damaging 1.00
R1424:Dock3 UTSW 9 106913193 missense probably damaging 1.00
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1469:Dock3 UTSW 9 106955709 missense probably benign 0.37
R1539:Dock3 UTSW 9 106952364 missense probably damaging 1.00
R1539:Dock3 UTSW 9 106996913 missense probably benign 0.23
R1571:Dock3 UTSW 9 106937959 missense possibly damaging 0.92
R1682:Dock3 UTSW 9 106973841 missense probably damaging 0.98
R1795:Dock3 UTSW 9 107025335 missense probably damaging 0.99
R1987:Dock3 UTSW 9 107108421 missense probably benign 0.01
R2000:Dock3 UTSW 9 106992961 splice site probably benign
R2074:Dock3 UTSW 9 106993463 missense possibly damaging 0.46
R2114:Dock3 UTSW 9 106993544 missense probably benign 0.00
R2265:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2269:Dock3 UTSW 9 106941326 missense probably damaging 1.00
R2370:Dock3 UTSW 9 106952355 missense probably damaging 1.00
R2377:Dock3 UTSW 9 106895891 missense probably damaging 0.98
R2385:Dock3 UTSW 9 106991125 missense probably damaging 1.00
R2426:Dock3 UTSW 9 106914541 missense possibly damaging 0.76
R3076:Dock3 UTSW 9 106941526 critical splice acceptor site probably null
R3122:Dock3 UTSW 9 106911343 missense probably damaging 0.99
R4052:Dock3 UTSW 9 106973796 missense probably damaging 0.99
R4294:Dock3 UTSW 9 106930043 missense probably damaging 1.00
R4623:Dock3 UTSW 9 107062045 missense possibly damaging 0.61
R4664:Dock3 UTSW 9 106993544 missense possibly damaging 0.71
R4705:Dock3 UTSW 9 107025336 missense probably damaging 1.00
R4771:Dock3 UTSW 9 106952358 missense possibly damaging 0.89
R4898:Dock3 UTSW 9 106930067 missense probably damaging 1.00
R4898:Dock3 UTSW 9 106992972 missense possibly damaging 0.75
R4961:Dock3 UTSW 9 106941316 missense probably damaging 1.00
R4986:Dock3 UTSW 9 106931983 missense probably damaging 1.00
R5054:Dock3 UTSW 9 106937906 missense probably damaging 1.00
R5065:Dock3 UTSW 9 106955684 missense probably damaging 1.00
R5081:Dock3 UTSW 9 106991093 missense probably damaging 1.00
R5101:Dock3 UTSW 9 106969781 missense probably damaging 1.00
R5135:Dock3 UTSW 9 106932997 missense probably damaging 1.00
R5227:Dock3 UTSW 9 106986070 missense probably damaging 1.00
R5257:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5258:Dock3 UTSW 9 106996925 missense probably damaging 1.00
R5273:Dock3 UTSW 9 106900705 critical splice donor site probably null
R5322:Dock3 UTSW 9 106901829 missense probably benign 0.14
R5482:Dock3 UTSW 9 106978738 nonsense probably null
R5553:Dock3 UTSW 9 106991110 missense possibly damaging 0.81
R5631:Dock3 UTSW 9 106955699 missense probably benign 0.01
R5739:Dock3 UTSW 9 106973796 missense possibly damaging 0.92
R5838:Dock3 UTSW 9 106895488 missense possibly damaging 0.51
R5888:Dock3 UTSW 9 107023803 missense probably benign 0.12
R5960:Dock3 UTSW 9 106911355 nonsense probably null
R5974:Dock3 UTSW 9 106994062 missense probably damaging 1.00
R6116:Dock3 UTSW 9 106931962 missense probably damaging 1.00
R6162:Dock3 UTSW 9 106964799 missense possibly damaging 0.88
R6176:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6219:Dock3 UTSW 9 106994881 missense probably damaging 1.00
R6238:Dock3 UTSW 9 106912948 missense probably benign 0.05
R6266:Dock3 UTSW 9 106964753 missense probably damaging 0.99
R6291:Dock3 UTSW 9 106908432 missense probably benign
R6531:Dock3 UTSW 9 106967216 missense probably benign
R6567:Dock3 UTSW 9 106896747 missense probably benign 0.13
R6572:Dock3 UTSW 9 106989475 missense probably damaging 0.99
R6620:Dock3 UTSW 9 106937926 missense probably benign 0.00
R6726:Dock3 UTSW 9 107159452 nonsense probably null
R7085:Dock3 UTSW 9 106901887 missense probably damaging 1.00
R7151:Dock3 UTSW 9 106964717 missense possibly damaging 0.68
R7320:Dock3 UTSW 9 106895524 missense probably benign 0.20
R7357:Dock3 UTSW 9 107005369 missense probably benign 0.34
R7423:Dock3 UTSW 9 106967171 missense probably damaging 0.98
R7426:Dock3 UTSW 9 106895583 missense probably benign
R7439:Dock3 UTSW 9 107023732 missense probably damaging 1.00
R7452:Dock3 UTSW 9 106989465 missense probably damaging 1.00
R7470:Dock3 UTSW 9 107005445 missense probably damaging 1.00
X0023:Dock3 UTSW 9 106985998 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGAAGCCTGGCTCTTTTCTAAG -3'
(R):5'- CTTAGCTAGGCAGAGACAGATAC -3'

Sequencing Primer
(F):5'- CCTGGCTCTTTTCTAAGGCTAGAAG -3'
(R):5'- GCAGAGACAGATACTAGATGTTTTTG -3'
Posted On2016-04-27