Incidental Mutation 'R4948:Trpm2'
ID383592
Institutional Source Beutler Lab
Gene Symbol Trpm2
Ensembl Gene ENSMUSG00000009292
Gene Nametransient receptor potential cation channel, subfamily M, member 2
SynonymsLTRPC2, 9830168K16Rik, TRPC7, Trrp7
MMRRC Submission 042545-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R4948 (G1)
Quality Score207
Status Validated
Chromosome10
Chromosomal Location77907722-77970563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77917792 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1293 (S1293T)
Ref Sequence ENSEMBL: ENSMUSP00000101040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105401]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105400
Predicted Effect probably benign
Transcript: ENSMUST00000105401
AA Change: S1293T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: S1293T

DomainStartEndE-ValueType
low complexity region 654 672 N/A INTRINSIC
transmembrane domain 750 772 N/A INTRINSIC
Pfam:Ion_trans 794 1057 3.7e-21 PFAM
low complexity region 1078 1090 N/A INTRINSIC
low complexity region 1106 1115 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
PDB:1QVJ|A 1236 1506 3e-37 PDB
SCOP:d1k2ea_ 1369 1502 9e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153842
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217806
Meta Mutation Damage Score 0.1550 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,290 probably null Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Alas1 A T 9: 106,246,878 L27* probably null Het
Aldh1a7 A G 19: 20,727,010 V40A possibly damaging Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
B3gnt5 A C 16: 19,769,144 M38L probably benign Het
Brd8 A G 18: 34,614,532 V92A probably damaging Het
Btla A T 16: 45,242,728 E151D probably benign Het
C87499 A T 4: 88,628,948 L162H probably damaging Het
Cd79b T A 11: 106,312,861 T67S probably benign Het
Cep192 A G 18: 67,816,804 R320G probably benign Het
Chad A C 11: 94,565,702 D202A probably damaging Het
Chil6 A G 3: 106,388,672 probably benign Het
Cpz T C 5: 35,517,404 E167G possibly damaging Het
Crisp2 T G 17: 40,765,268 H225P probably damaging Het
Cyp2c23 T C 19: 44,021,699 Y69C possibly damaging Het
Dcp1a T A 14: 30,479,767 L49H probably damaging Het
Dnah6 T A 6: 73,053,689 H3380L probably benign Het
Dnm2 A G 9: 21,504,533 D721G possibly damaging Het
Dnpep G T 1: 75,316,760 T15K probably benign Het
Dock3 A T 9: 106,991,155 D643E probably damaging Het
Ear6 C T 14: 51,854,116 T40I possibly damaging Het
Fancm A G 12: 65,090,974 D313G probably damaging Het
Fbxw16 T A 9: 109,438,347 E272V probably damaging Het
Frmd4b T A 6: 97,306,730 E393D probably benign Het
Fryl T A 5: 73,089,130 M1100L probably benign Het
Gjc1 T C 11: 102,800,421 H252R probably damaging Het
Gm10518 T C 1: 179,803,912 probably benign Het
Gna14 A G 19: 16,603,292 M165V probably benign Het
Hells C A 19: 38,935,522 Q72K probably damaging Het
Herc1 A G 9: 66,484,902 I4031V probably benign Het
Hspa2 C T 12: 76,405,987 A485V probably damaging Het
Ighv1-54 T A 12: 115,193,818 I70F probably benign Het
Il20rb A T 9: 100,461,539 probably benign Het
Krt1 C A 15: 101,845,941 V625L unknown Het
Lamc3 T C 2: 31,940,736 I1495T probably benign Het
Larp6 A G 9: 60,737,780 E401G possibly damaging Het
Ldha A T 7: 46,847,381 H19L probably benign Het
Lrba A G 3: 86,285,028 N83S probably damaging Het
Lrp4 G T 2: 91,485,886 R783L probably benign Het
Lrrk2 T G 15: 91,803,389 I2227S probably benign Het
Lvrn T C 18: 46,880,736 L495P probably damaging Het
Macf1 T C 4: 123,497,755 N1077S probably damaging Het
Mboat1 A G 13: 30,241,230 T425A probably damaging Het
Mcam A G 9: 44,136,566 E36G probably damaging Het
Meis1 T A 11: 19,016,308 T22S probably benign Het
Micu1 A G 10: 59,863,254 K451R possibly damaging Het
Mrvi1 A G 7: 110,888,029 V498A probably damaging Het
Nat8 A T 6: 85,830,523 D209E probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nmral1 G A 16: 4,716,410 R56* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1002 T C 2: 85,647,572 I250V probably benign Het
Olfr1408 A G 1: 173,130,959 V86A probably benign Het
Olfr1451 A T 19: 12,999,831 T282S probably benign Het
Olfr192 G A 16: 59,098,977 T5I probably damaging Het
Palm3 A T 8: 84,027,079 R132* probably null Het
Pax2 A G 19: 44,816,040 Y272C probably damaging Het
Phc2 G A 4: 128,723,115 A394T probably benign Het
Phf2 C A 13: 48,807,722 G831C unknown Het
Pik3c2b G A 1: 133,099,715 probably null Het
Plin2 T A 4: 86,661,991 I178F probably benign Het
Prdm14 T A 1: 13,122,631 I295F probably damaging Het
Psmd5 C T 2: 34,870,783 R47H probably benign Het
Ptchd3 T A 11: 121,842,516 I744K probably damaging Het
Ptrh1 T A 2: 32,776,545 probably benign Het
Rab6a A G 7: 100,628,420 D49G probably damaging Het
Radil A T 5: 142,485,239 D1062E probably benign Het
Robo2 A G 16: 74,352,838 V34A possibly damaging Het
Sall3 G A 18: 80,971,411 P1029S probably benign Het
Sec14l3 A G 11: 4,068,101 D127G possibly damaging Het
Sel1l2 A G 2: 140,244,166 Y502H probably damaging Het
Serpina1f A G 12: 103,689,751 V406A probably damaging Het
Sf3b3 T C 8: 110,813,669 D1040G probably damaging Het
Sgcd A G 11: 46,979,435 I233T possibly damaging Het
Slc15a3 A G 19: 10,843,046 Q9R probably benign Het
Slc25a46 A G 18: 31,583,283 F389L probably damaging Het
Slc26a2 G T 18: 61,198,258 C700* probably null Het
Slc4a7 A G 14: 14,771,283 Y671C possibly damaging Het
Slc5a10 A T 11: 61,719,882 I22N probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc6a12 A G 6: 121,355,322 D205G probably benign Het
Tas2r115 G A 6: 132,737,161 H276Y probably damaging Het
Tdpoz4 T A 3: 93,797,011 I205N probably damaging Het
Tfeb C T 17: 47,785,979 T33I probably benign Het
Tgm3 A G 2: 130,048,320 T668A probably benign Het
Tnpo3 A G 6: 29,582,260 V201A probably benign Het
Tpcn1 T A 5: 120,556,531 M158L probably benign Het
Trim47 A C 11: 116,106,092 L612R probably damaging Het
Trmt10c A T 16: 56,034,075 L399* probably null Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Tubgcp5 A G 7: 55,806,123 I300V probably benign Het
Uty T A Y: 1,136,883 Q844L probably damaging Het
Vmn2r85 C T 10: 130,419,121 E565K probably damaging Het
Vmn2r97 T C 17: 18,947,299 V605A possibly damaging Het
Vwa3a T C 7: 120,776,264 V399A probably damaging Het
Wdr63 T A 3: 146,083,065 K254* probably null Het
Wnk4 G A 11: 101,268,281 R508Q probably damaging Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp616 T A 11: 74,084,004 N457K possibly damaging Het
Other mutations in Trpm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Trpm2 APN 10 77942915 splice site probably null
IGL00773:Trpm2 APN 10 77949214 nonsense probably null
IGL00962:Trpm2 APN 10 77943916 splice site probably benign
IGL01093:Trpm2 APN 10 77932280 missense probably benign 0.04
IGL01124:Trpm2 APN 10 77945825 splice site probably benign
IGL01301:Trpm2 APN 10 77923984 missense probably damaging 1.00
IGL02094:Trpm2 APN 10 77942996 nonsense probably null
IGL02175:Trpm2 APN 10 77937907 missense probably benign 0.07
IGL02653:Trpm2 APN 10 77912669 missense probably benign 0.19
IGL02667:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02668:Trpm2 APN 10 77935942 missense probably damaging 1.00
IGL02828:Trpm2 APN 10 77918986 missense probably benign 0.16
IGL02951:Trpm2 APN 10 77929278 missense possibly damaging 0.95
IGL03188:Trpm2 APN 10 77918909 missense probably benign 0.18
IGL03242:Trpm2 APN 10 77917734 missense probably benign
IGL03405:Trpm2 APN 10 77966072 splice site probably benign
Fugit UTSW 10 77938368 missense probably damaging 1.00
scusate UTSW 10 77966994 nonsense probably null
temporal UTSW 10 77925682 missense probably benign 0.30
ANU18:Trpm2 UTSW 10 77923984 missense probably damaging 1.00
R0147:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0148:Trpm2 UTSW 10 77925825 missense probably damaging 1.00
R0302:Trpm2 UTSW 10 77943990 splice site probably benign
R0332:Trpm2 UTSW 10 77947988 missense probably damaging 1.00
R0586:Trpm2 UTSW 10 77923516 missense probably damaging 0.99
R0847:Trpm2 UTSW 10 77929288 missense possibly damaging 0.94
R1183:Trpm2 UTSW 10 77923564 missense probably damaging 1.00
R1472:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R1510:Trpm2 UTSW 10 77966994 nonsense probably null
R1518:Trpm2 UTSW 10 77943005 missense possibly damaging 0.67
R1564:Trpm2 UTSW 10 77942999 missense probably benign 0.14
R1593:Trpm2 UTSW 10 77943076 missense possibly damaging 0.71
R1617:Trpm2 UTSW 10 77935875 splice site probably null
R1673:Trpm2 UTSW 10 77942944 missense probably benign
R1912:Trpm2 UTSW 10 77945876 missense probably benign 0.10
R1932:Trpm2 UTSW 10 77941158 missense probably damaging 1.00
R1993:Trpm2 UTSW 10 77947989 missense probably damaging 1.00
R2013:Trpm2 UTSW 10 77925766 missense probably damaging 1.00
R2151:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R2201:Trpm2 UTSW 10 77920471 nonsense probably null
R2217:Trpm2 UTSW 10 77941182 missense probably damaging 1.00
R2312:Trpm2 UTSW 10 77918964 missense probably benign 0.04
R2339:Trpm2 UTSW 10 77914806 splice site probably benign
R2395:Trpm2 UTSW 10 77947880 missense possibly damaging 0.69
R2396:Trpm2 UTSW 10 77930637 missense probably benign 0.14
R2405:Trpm2 UTSW 10 77934724 missense probably damaging 1.00
R2567:Trpm2 UTSW 10 77941174 missense probably damaging 0.99
R3001:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3002:Trpm2 UTSW 10 77930534 critical splice donor site probably null
R3125:Trpm2 UTSW 10 77911374 missense probably damaging 1.00
R3500:Trpm2 UTSW 10 77932302 missense probably benign 0.03
R3777:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R3778:Trpm2 UTSW 10 77935990 missense probably benign 0.13
R4272:Trpm2 UTSW 10 77933642 missense probably damaging 1.00
R4384:Trpm2 UTSW 10 77917725 missense probably benign 0.44
R4395:Trpm2 UTSW 10 77929219 missense probably benign 0.01
R4423:Trpm2 UTSW 10 77935068 missense probably benign 0.00
R4452:Trpm2 UTSW 10 77923593 missense probably damaging 1.00
R4612:Trpm2 UTSW 10 77945916 missense probably damaging 0.99
R4662:Trpm2 UTSW 10 77938138 missense probably benign 0.05
R4825:Trpm2 UTSW 10 77941173 missense probably damaging 0.98
R4906:Trpm2 UTSW 10 77932189 nonsense probably null
R4943:Trpm2 UTSW 10 77966007 missense probably damaging 1.00
R5046:Trpm2 UTSW 10 77966018 missense probably damaging 1.00
R5320:Trpm2 UTSW 10 77923521 missense probably benign 0.06
R5523:Trpm2 UTSW 10 77935961 missense probably benign 0.04
R5562:Trpm2 UTSW 10 77959939 missense possibly damaging 0.71
R5623:Trpm2 UTSW 10 77932139 missense probably damaging 0.96
R5628:Trpm2 UTSW 10 77912636 missense probably benign 0.00
R5633:Trpm2 UTSW 10 77938353 missense possibly damaging 0.71
R5817:Trpm2 UTSW 10 77965980 missense probably damaging 1.00
R5989:Trpm2 UTSW 10 77959900 missense probably damaging 1.00
R6018:Trpm2 UTSW 10 77917713 missense probably benign 0.00
R6075:Trpm2 UTSW 10 77935043 critical splice donor site probably null
R6092:Trpm2 UTSW 10 77925682 missense probably benign 0.30
R6309:Trpm2 UTSW 10 77938368 missense probably damaging 1.00
R6327:Trpm2 UTSW 10 77932227 missense probably damaging 1.00
R6568:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6579:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6640:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6642:Trpm2 UTSW 10 77937826 missense probably benign 0.01
R6798:Trpm2 UTSW 10 77914740 missense probably damaging 0.99
R6999:Trpm2 UTSW 10 77935891 missense probably damaging 1.00
R7034:Trpm2 UTSW 10 77912592 missense probably benign
R7036:Trpm2 UTSW 10 77912592 missense probably benign
R7113:Trpm2 UTSW 10 77947931 missense probably damaging 0.96
R7171:Trpm2 UTSW 10 77924014 missense probably damaging 1.00
R7240:Trpm2 UTSW 10 77935876 critical splice donor site probably null
R7274:Trpm2 UTSW 10 77923555 missense probably benign 0.00
R7379:Trpm2 UTSW 10 77914734 missense probably benign
R7527:Trpm2 UTSW 10 77966060 missense probably benign 0.01
R7571:Trpm2 UTSW 10 77937950 missense probably benign 0.21
R7600:Trpm2 UTSW 10 77938051 missense probably benign 0.02
R7727:Trpm2 UTSW 10 77925789 missense probably benign 0.34
R7771:Trpm2 UTSW 10 77932179 missense probably benign 0.01
R7844:Trpm2 UTSW 10 77923506 missense probably benign 0.00
R8158:Trpm2 UTSW 10 77947897 missense probably damaging 0.99
R8225:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8226:Trpm2 UTSW 10 77947973 missense probably damaging 1.00
R8239:Trpm2 UTSW 10 77936002 missense probably benign 0.06
R8275:Trpm2 UTSW 10 77966025 nonsense probably null
R8340:Trpm2 UTSW 10 77923624 nonsense probably null
Z1177:Trpm2 UTSW 10 77937868 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCTGAGGGAACAGCACACAC -3'
(R):5'- TGTCCCAGATACAACTCATTCTGAC -3'

Sequencing Primer
(F):5'- GGAACAGCACACACCGAGTTTC -3'
(R):5'- CTCATTCTGACAATGGGCATGAGC -3'
Posted On2016-04-27