Incidental Mutation 'R4948:Lrrk2'
ID383618
Institutional Source Beutler Lab
Gene Symbol Lrrk2
Ensembl Gene ENSMUSG00000036273
Gene Nameleucine-rich repeat kinase 2
Synonyms9330188B09Rik, 4921513O20Rik, LOC381026, cI-46, D630001M17Rik
MMRRC Submission 042545-MU
Accession Numbers

Genbank: NM_025730; MGI: 1913975

Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R4948 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location91673175-91816120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 91803389 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 2227 (I2227S)
Ref Sequence ENSEMBL: ENSMUSP00000052584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060642]
Predicted Effect probably benign
Transcript: ENSMUST00000060642
AA Change: I2227S

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000052584
Gene: ENSMUSG00000036273
AA Change: I2227S

DomainStartEndE-ValueType
low complexity region 138 156 N/A INTRINSIC
low complexity region 332 347 N/A INTRINSIC
ANK 708 737 3.95e1 SMART
ANK 770 800 4.58e2 SMART
low complexity region 890 901 N/A INTRINSIC
low complexity region 953 966 N/A INTRINSIC
low complexity region 971 979 N/A INTRINSIC
LRR 1010 1033 9.96e-1 SMART
LRR 1034 1057 8.01e0 SMART
LRR 1082 1105 2.45e0 SMART
LRR 1128 1151 9.3e-1 SMART
LRR 1195 1219 3.24e0 SMART
LRR 1244 1266 3.87e1 SMART
LRR 1267 1291 4.98e1 SMART
Pfam:Roc 1336 1456 4.9e-32 PFAM
Pfam:Ras 1336 1489 3.3e-17 PFAM
Pfam:COR 1524 1740 4e-28 PFAM
Pfam:Pkinase 1881 2132 4.7e-40 PFAM
Pfam:Pkinase_Tyr 1882 2132 6.8e-39 PFAM
WD40 2231 2276 3.09e-1 SMART
WD40 2401 2438 1.37e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133743
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137657
Meta Mutation Damage Score 0.4443 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.2%
Validation Efficiency 94% (103/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the leucine-rich repeat kinase family and encodes a protein with an ankryin repeat region, a leucine-rich repeat (LRR) domain, a kinase domain, a DFG-like motif, a RAS domain, a GTPase domain, a MLK-like domain, and a WD40 domain. The protein is present largely in the cytoplasm but also associates with the mitochondrial outer membrane. Mutations in this gene have been associated with Parkinson disease-8. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired response to dopamine, amphetamine, and quinpirole. Mice homozygous for one knock-out allele exhibit increased neurite growth. Mice homozygous for different knock-out alleles exhibit alopecia due to excessive grooming or kdiney atrophy. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(6) Targeted, other(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610318N02Rik A T 16: 17,118,290 probably null Het
Adcy4 C T 14: 55,779,029 D322N probably damaging Het
Alas1 A T 9: 106,246,878 L27* probably null Het
Aldh1a7 A G 19: 20,727,010 V40A possibly damaging Het
Appbp2 A T 11: 85,194,583 I499K possibly damaging Het
B3gnt5 A C 16: 19,769,144 M38L probably benign Het
Brd8 A G 18: 34,614,532 V92A probably damaging Het
Btla A T 16: 45,242,728 E151D probably benign Het
C87499 A T 4: 88,628,948 L162H probably damaging Het
Cd79b T A 11: 106,312,861 T67S probably benign Het
Cep192 A G 18: 67,816,804 R320G probably benign Het
Chad A C 11: 94,565,702 D202A probably damaging Het
Chil6 A G 3: 106,388,672 probably benign Het
Cpz T C 5: 35,517,404 E167G possibly damaging Het
Crisp2 T G 17: 40,765,268 H225P probably damaging Het
Cyp2c23 T C 19: 44,021,699 Y69C possibly damaging Het
Dcp1a T A 14: 30,479,767 L49H probably damaging Het
Dnah6 T A 6: 73,053,689 H3380L probably benign Het
Dnm2 A G 9: 21,504,533 D721G possibly damaging Het
Dnpep G T 1: 75,316,760 T15K probably benign Het
Dock3 A T 9: 106,991,155 D643E probably damaging Het
Ear6 C T 14: 51,854,116 T40I possibly damaging Het
Fancm A G 12: 65,090,974 D313G probably damaging Het
Fbxw16 T A 9: 109,438,347 E272V probably damaging Het
Frmd4b T A 6: 97,306,730 E393D probably benign Het
Fryl T A 5: 73,089,130 M1100L probably benign Het
Gjc1 T C 11: 102,800,421 H252R probably damaging Het
Gm10518 T C 1: 179,803,912 probably benign Het
Gna14 A G 19: 16,603,292 M165V probably benign Het
Hells C A 19: 38,935,522 Q72K probably damaging Het
Herc1 A G 9: 66,484,902 I4031V probably benign Het
Hspa2 C T 12: 76,405,987 A485V probably damaging Het
Ighv1-54 T A 12: 115,193,818 I70F probably benign Het
Il20rb A T 9: 100,461,539 probably benign Het
Krt1 C A 15: 101,845,941 V625L unknown Het
Lamc3 T C 2: 31,940,736 I1495T probably benign Het
Larp6 A G 9: 60,737,780 E401G possibly damaging Het
Ldha A T 7: 46,847,381 H19L probably benign Het
Lrba A G 3: 86,285,028 N83S probably damaging Het
Lrp4 G T 2: 91,485,886 R783L probably benign Het
Lvrn T C 18: 46,880,736 L495P probably damaging Het
Macf1 T C 4: 123,497,755 N1077S probably damaging Het
Mboat1 A G 13: 30,241,230 T425A probably damaging Het
Mcam A G 9: 44,136,566 E36G probably damaging Het
Meis1 T A 11: 19,016,308 T22S probably benign Het
Micu1 A G 10: 59,863,254 K451R possibly damaging Het
Mrvi1 A G 7: 110,888,029 V498A probably damaging Het
Nat8 A T 6: 85,830,523 D209E probably benign Het
Nek10 T A 14: 14,860,986 L513M possibly damaging Het
Nmral1 G A 16: 4,716,410 R56* probably null Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Olfr1002 T C 2: 85,647,572 I250V probably benign Het
Olfr1408 A G 1: 173,130,959 V86A probably benign Het
Olfr1451 A T 19: 12,999,831 T282S probably benign Het
Olfr192 G A 16: 59,098,977 T5I probably damaging Het
Palm3 A T 8: 84,027,079 R132* probably null Het
Pax2 A G 19: 44,816,040 Y272C probably damaging Het
Phc2 G A 4: 128,723,115 A394T probably benign Het
Phf2 C A 13: 48,807,722 G831C unknown Het
Pik3c2b G A 1: 133,099,715 probably null Het
Plin2 T A 4: 86,661,991 I178F probably benign Het
Prdm14 T A 1: 13,122,631 I295F probably damaging Het
Psmd5 C T 2: 34,870,783 R47H probably benign Het
Ptchd3 T A 11: 121,842,516 I744K probably damaging Het
Ptrh1 T A 2: 32,776,545 probably benign Het
Rab6a A G 7: 100,628,420 D49G probably damaging Het
Radil A T 5: 142,485,239 D1062E probably benign Het
Robo2 A G 16: 74,352,838 V34A possibly damaging Het
Sall3 G A 18: 80,971,411 P1029S probably benign Het
Sec14l3 A G 11: 4,068,101 D127G possibly damaging Het
Sel1l2 A G 2: 140,244,166 Y502H probably damaging Het
Serpina1f A G 12: 103,689,751 V406A probably damaging Het
Sf3b3 T C 8: 110,813,669 D1040G probably damaging Het
Sgcd A G 11: 46,979,435 I233T possibly damaging Het
Slc15a3 A G 19: 10,843,046 Q9R probably benign Het
Slc25a46 A G 18: 31,583,283 F389L probably damaging Het
Slc26a2 G T 18: 61,198,258 C700* probably null Het
Slc4a7 A G 14: 14,771,283 Y671C possibly damaging Het
Slc5a10 A T 11: 61,719,882 I22N probably damaging Het
Slc5a9 C A 4: 111,891,744 probably null Het
Slc6a12 A G 6: 121,355,322 D205G probably benign Het
Tas2r115 G A 6: 132,737,161 H276Y probably damaging Het
Tdpoz4 T A 3: 93,797,011 I205N probably damaging Het
Tfeb C T 17: 47,785,979 T33I probably benign Het
Tgm3 A G 2: 130,048,320 T668A probably benign Het
Tnpo3 A G 6: 29,582,260 V201A probably benign Het
Tpcn1 T A 5: 120,556,531 M158L probably benign Het
Trim47 A C 11: 116,106,092 L612R probably damaging Het
Trmt10c A T 16: 56,034,075 L399* probably null Het
Trpm2 A T 10: 77,917,792 S1293T probably benign Het
Ttn C T 2: 76,752,597 V22651I probably damaging Het
Tubgcp5 A G 7: 55,806,123 I300V probably benign Het
Uty T A Y: 1,136,883 Q844L probably damaging Het
Vmn2r85 C T 10: 130,419,121 E565K probably damaging Het
Vmn2r97 T C 17: 18,947,299 V605A possibly damaging Het
Vwa3a T C 7: 120,776,264 V399A probably damaging Het
Wdr63 T A 3: 146,083,065 K254* probably null Het
Wnk4 G A 11: 101,268,281 R508Q probably damaging Het
Zfp217 A G 2: 170,119,210 V399A probably damaging Het
Zfp616 T A 11: 74,084,004 N457K possibly damaging Het
Other mutations in Lrrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Lrrk2 APN 15 91747799 missense possibly damaging 0.90
IGL00542:Lrrk2 APN 15 91699943 missense probably benign
IGL00770:Lrrk2 APN 15 91801833 splice site probably benign
IGL00774:Lrrk2 APN 15 91801833 splice site probably benign
IGL00791:Lrrk2 APN 15 91779841 missense probably damaging 1.00
IGL00827:Lrrk2 APN 15 91755790 missense probably damaging 1.00
IGL00843:Lrrk2 APN 15 91757058 missense possibly damaging 0.58
IGL01109:Lrrk2 APN 15 91738832 missense probably damaging 1.00
IGL01293:Lrrk2 APN 15 91726137 missense probably benign 0.21
IGL01296:Lrrk2 APN 15 91683142 missense probably benign
IGL01301:Lrrk2 APN 15 91767339 missense probably damaging 1.00
IGL01360:Lrrk2 APN 15 91700569 splice site probably null
IGL01465:Lrrk2 APN 15 91728925 missense probably benign 0.21
IGL01529:Lrrk2 APN 15 91812313 missense possibly damaging 0.92
IGL01557:Lrrk2 APN 15 91699989 missense probably damaging 1.00
IGL01560:Lrrk2 APN 15 91774988 missense probably benign 0.33
IGL01991:Lrrk2 APN 15 91779946 missense probably damaging 0.99
IGL02003:Lrrk2 APN 15 91731491 missense probably damaging 0.99
IGL02325:Lrrk2 APN 15 91726308 critical splice donor site probably null
IGL02711:Lrrk2 APN 15 91685822 missense possibly damaging 0.71
IGL02869:Lrrk2 APN 15 91750277 missense probably damaging 1.00
IGL03104:Lrrk2 APN 15 91747755 missense possibly damaging 0.68
IGL03179:Lrrk2 APN 15 91700578 missense probably damaging 1.00
IGL03395:Lrrk2 APN 15 91797414 splice site probably null
horned UTSW 15 91772858 missense probably damaging 1.00
R1312_Lrrk2_980 UTSW 15 91699895 missense probably damaging 1.00
R4710_lrrk2_232 UTSW 15 91699927 missense possibly damaging 0.88
R5245_Lrrk2_127 UTSW 15 91796089 missense probably damaging 1.00
spree UTSW 15 91702247 missense probably benign 0.00
Spur UTSW 15 91774995 nonsense probably null
3-1:Lrrk2 UTSW 15 91801934 missense probably benign 0.01
ANU18:Lrrk2 UTSW 15 91767339 missense probably damaging 1.00
H8562:Lrrk2 UTSW 15 91673358 missense probably benign
H8786:Lrrk2 UTSW 15 91673358 missense probably benign
IGL02835:Lrrk2 UTSW 15 91814660 critical splice acceptor site probably null
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0014:Lrrk2 UTSW 15 91802045 splice site probably benign
R0078:Lrrk2 UTSW 15 91734009 missense probably benign 0.01
R0100:Lrrk2 UTSW 15 91745796 missense probably damaging 1.00
R0282:Lrrk2 UTSW 15 91778414 splice site probably benign
R0448:Lrrk2 UTSW 15 91709305 missense probably damaging 0.99
R0449:Lrrk2 UTSW 15 91750275 missense probably damaging 1.00
R0610:Lrrk2 UTSW 15 91815416 missense probably benign
R0617:Lrrk2 UTSW 15 91752278 missense probably benign 0.00
R0632:Lrrk2 UTSW 15 91796028 missense probably damaging 0.98
R0639:Lrrk2 UTSW 15 91772996 missense probably benign 0.03
R0661:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R0666:Lrrk2 UTSW 15 91757070 critical splice donor site probably null
R0764:Lrrk2 UTSW 15 91775046 splice site probably null
R0766:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R0845:Lrrk2 UTSW 15 91755962 missense probably benign 0.22
R0940:Lrrk2 UTSW 15 91729081 missense possibly damaging 0.83
R0970:Lrrk2 UTSW 15 91729169 missense probably benign 0.22
R1080:Lrrk2 UTSW 15 91673689 missense probably benign 0.01
R1114:Lrrk2 UTSW 15 91700468 nonsense probably null
R1223:Lrrk2 UTSW 15 91673635 missense probably benign 0.00
R1289:Lrrk2 UTSW 15 91812360 missense probably benign 0.00
R1296:Lrrk2 UTSW 15 91728920 missense probably damaging 1.00
R1312:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R1637:Lrrk2 UTSW 15 91734058 missense probably benign
R1773:Lrrk2 UTSW 15 91779981 missense possibly damaging 0.96
R1809:Lrrk2 UTSW 15 91699892 missense possibly damaging 0.86
R1839:Lrrk2 UTSW 15 91683134 missense probably benign 0.00
R1946:Lrrk2 UTSW 15 91736661 splice site probably null
R2160:Lrrk2 UTSW 15 91796060 missense probably damaging 1.00
R2232:Lrrk2 UTSW 15 91764716 missense probably benign 0.05
R2419:Lrrk2 UTSW 15 91797526 splice site probably benign
R2516:Lrrk2 UTSW 15 91755927 missense probably benign
R3110:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3112:Lrrk2 UTSW 15 91814695 missense probably benign 0.02
R3801:Lrrk2 UTSW 15 91737111 missense probably benign
R3842:Lrrk2 UTSW 15 91755916 missense probably benign 0.01
R3903:Lrrk2 UTSW 15 91747700 missense probably damaging 1.00
R3903:Lrrk2 UTSW 15 91747701 missense probably damaging 1.00
R3930:Lrrk2 UTSW 15 91767461 critical splice donor site probably null
R3937:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3938:Lrrk2 UTSW 15 91712780 missense possibly damaging 0.69
R3938:Lrrk2 UTSW 15 91778504 missense probably damaging 0.98
R3982:Lrrk2 UTSW 15 91709284 missense probably benign 0.22
R4125:Lrrk2 UTSW 15 91815483 missense probably benign 0.01
R4130:Lrrk2 UTSW 15 91755794 missense probably benign 0.19
R4296:Lrrk2 UTSW 15 91699895 missense probably damaging 1.00
R4465:Lrrk2 UTSW 15 91747820 missense probably damaging 0.96
R4478:Lrrk2 UTSW 15 91723188 missense probably damaging 1.00
R4517:Lrrk2 UTSW 15 91705120 missense probably benign
R4539:Lrrk2 UTSW 15 91729142 missense possibly damaging 0.86
R4654:Lrrk2 UTSW 15 91765681 missense probably damaging 0.96
R4710:Lrrk2 UTSW 15 91699927 missense possibly damaging 0.88
R4722:Lrrk2 UTSW 15 91688901 missense probably damaging 1.00
R4723:Lrrk2 UTSW 15 91764759 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4732:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91688849 missense probably damaging 1.00
R4733:Lrrk2 UTSW 15 91765747 missense probably damaging 1.00
R4787:Lrrk2 UTSW 15 91712828 missense probably benign
R4945:Lrrk2 UTSW 15 91804920 missense probably benign 0.02
R5000:Lrrk2 UTSW 15 91749878 missense probably damaging 1.00
R5031:Lrrk2 UTSW 15 91700619 missense possibly damaging 0.50
R5067:Lrrk2 UTSW 15 91765790 missense probably benign 0.01
R5245:Lrrk2 UTSW 15 91796089 missense probably damaging 1.00
R5341:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R5460:Lrrk2 UTSW 15 91814644 splice site probably null
R5551:Lrrk2 UTSW 15 91812350 missense probably benign
R5574:Lrrk2 UTSW 15 91787016 missense probably damaging 1.00
R5577:Lrrk2 UTSW 15 91765745 missense probably damaging 1.00
R5685:Lrrk2 UTSW 15 91803301 nonsense probably null
R5712:Lrrk2 UTSW 15 91702222 nonsense probably null
R5728:Lrrk2 UTSW 15 91774974 missense probably benign 0.36
R5782:Lrrk2 UTSW 15 91702183 missense probably damaging 1.00
R5788:Lrrk2 UTSW 15 91764648 missense possibly damaging 0.55
R5821:Lrrk2 UTSW 15 91709390 critical splice donor site probably null
R5852:Lrrk2 UTSW 15 91755949 missense probably damaging 1.00
R5934:Lrrk2 UTSW 15 91734046 missense probably benign 0.00
R5935:Lrrk2 UTSW 15 91745831 missense probably benign 0.14
R5979:Lrrk2 UTSW 15 91772945 missense possibly damaging 0.47
R6101:Lrrk2 UTSW 15 91723135 missense probably benign 0.10
R6114:Lrrk2 UTSW 15 91747826 missense probably benign 0.33
R6259:Lrrk2 UTSW 15 91702247 missense probably benign 0.00
R6376:Lrrk2 UTSW 15 91742266 missense possibly damaging 0.89
R6417:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6420:Lrrk2 UTSW 15 91812346 missense probably benign 0.03
R6737:Lrrk2 UTSW 15 91723218 missense possibly damaging 0.50
R7056:Lrrk2 UTSW 15 91774995 nonsense probably null
R7072:Lrrk2 UTSW 15 91801920 missense probably benign 0.03
R7109:Lrrk2 UTSW 15 91764782 missense probably damaging 1.00
R7128:Lrrk2 UTSW 15 91801885 missense probably benign
R7144:Lrrk2 UTSW 15 91734055 missense possibly damaging 0.54
R7187:Lrrk2 UTSW 15 91757001 missense possibly damaging 0.92
R7270:Lrrk2 UTSW 15 91700441 missense probably benign 0.01
R7356:Lrrk2 UTSW 15 91738744 missense probably benign 0.07
R7360:Lrrk2 UTSW 15 91731655 critical splice donor site probably null
R7373:Lrrk2 UTSW 15 91700004 critical splice donor site probably null
R7465:Lrrk2 UTSW 15 91767340 missense probably damaging 1.00
R7477:Lrrk2 UTSW 15 91812325 missense probably damaging 0.98
R7614:Lrrk2 UTSW 15 91772858 missense probably damaging 1.00
R7622:Lrrk2 UTSW 15 91812323 missense probably damaging 1.00
R7658:Lrrk2 UTSW 15 91700358 missense possibly damaging 0.91
R7679:Lrrk2 UTSW 15 91726186 missense possibly damaging 0.58
R7737:Lrrk2 UTSW 15 91815446 missense probably damaging 0.98
R7739:Lrrk2 UTSW 15 91700613 missense probably damaging 1.00
R7740:Lrrk2 UTSW 15 91767324 missense probably damaging 1.00
R7908:Lrrk2 UTSW 15 91726152 missense probably damaging 1.00
R8299:Lrrk2 UTSW 15 91673240 start gained probably benign
R8389:Lrrk2 UTSW 15 91699991 missense probably damaging 1.00
R8462:Lrrk2 UTSW 15 91731477 missense probably benign
R8698:Lrrk2 UTSW 15 91752197 missense probably benign 0.38
RF001:Lrrk2 UTSW 15 91736633 missense probably benign 0.11
X0028:Lrrk2 UTSW 15 91738851 missense probably benign 0.00
Z1088:Lrrk2 UTSW 15 91726240 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GCATTGATTGTAAAAGTAAAGGCGC -3'
(R):5'- AGCAGAAGTCAGGAAATCTCTACTG -3'

Sequencing Primer
(F):5'- AGGATGTTGATAACAGGATGTTTTC -3'
(R):5'- CTGATGTAATAATGCTGCAAATGAC -3'
Posted On2016-04-27