Incidental Mutation 'R0333:Smad2'
ID38364
Institutional Source Beutler Lab
Gene Symbol Smad2
Ensembl Gene ENSMUSG00000024563
Gene NameSMAD family member 2
SynonymsSmad 2, Madr2, 7120426M23Rik, Madh2
MMRRC Submission 038542-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0333 (G1)
Quality Score199
Status Validated
Chromosome18
Chromosomal Location76241580-76305731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76262621 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 44 (A44T)
Ref Sequence ENSEMBL: ENSMUSP00000125883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]
Predicted Effect probably damaging
Transcript: ENSMUST00000025453
AA Change: A44T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: A44T

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091831
AA Change: A44T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563
AA Change: A44T

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 1e-10 BLAST
DWB 242 413 2.25e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113930
AA Change: A44T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: A44T

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 9e-11 BLAST
DWB 242 408 4.38e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165084
AA Change: A44T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563
AA Change: A44T

DomainStartEndE-ValueType
DWA 36 144 7.85e-67 SMART
PDB:1KHX|A 166 204 3e-19 PDB
SCOP:d1khxa_ 190 204 7e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168423
AA Change: A44T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: A44T

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171256
AA Change: A44T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563
AA Change: A44T

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWA 182 213 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172198
SMART Domains Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
Pfam:MH2 28 58 1.8e-10 PFAM
Meta Mutation Damage Score 0.7109 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 T C 9: 106,241,281 N214S probably benign Het
Antxr1 A G 6: 87,188,838 probably benign Het
Atxn7l3 A T 11: 102,294,992 probably null Het
Cab39l A G 14: 59,499,611 E60G probably damaging Het
Cdc5l G T 17: 45,393,216 probably benign Het
Cux2 T C 5: 121,860,608 E1423G probably benign Het
Dbndd1 G T 8: 123,506,773 Q165K probably damaging Het
Drd1 C A 13: 54,054,063 C37F probably damaging Het
Elp3 G A 14: 65,590,593 P11L probably benign Het
F830045P16Rik A G 2: 129,472,857 Y167H probably damaging Het
Gimap3 G A 6: 48,765,730 Q89* probably null Het
Herc1 G A 9: 66,464,699 probably null Het
Hist3h2a C A 11: 58,954,859 S41* probably null Het
Ipo11 A G 13: 106,870,763 V603A probably benign Het
Kifap3 G A 1: 163,797,264 A130T probably damaging Het
Klhl23 A G 2: 69,833,897 Y530C probably damaging Het
Map4k1 C T 7: 28,999,761 probably benign Het
Mroh2b T A 15: 4,931,118 L778M probably damaging Het
Mtdh T C 15: 34,118,101 S344P possibly damaging Het
Ncoa3 T G 2: 166,054,291 N371K probably damaging Het
Ncor2 C A 5: 125,034,344 probably benign Het
Nrn1l A G 8: 105,894,420 E48G probably benign Het
Nudcd1 A G 15: 44,401,287 I271T probably benign Het
Olfr23 A T 11: 73,940,767 I174F possibly damaging Het
Olfr31 T C 14: 14,328,498 L129P probably damaging Het
Pard3b A G 1: 62,230,212 N653S probably benign Het
Park2 T C 17: 11,067,140 F6L probably damaging Het
Plekhg1 A C 10: 3,964,419 K1380N probably damaging Het
Ppara T A 15: 85,790,960 I210N probably damaging Het
Ppp2r5b A G 19: 6,229,047 probably benign Het
Prr14l A G 5: 32,827,993 L1386P probably damaging Het
Ralgapa1 A G 12: 55,782,900 probably benign Het
Reln A T 5: 21,929,242 L2563I probably damaging Het
Rps7 A G 12: 28,631,201 probably benign Het
Rslcan18 T C 13: 67,098,622 K309E probably damaging Het
Sec14l5 C T 16: 5,167,066 T92M probably damaging Het
Slc22a8 G A 19: 8,608,150 probably benign Het
Smcr8 T C 11: 60,780,222 V732A possibly damaging Het
Spata2l A G 8: 123,233,632 F306S probably damaging Het
Stab2 T C 10: 86,841,627 D2552G probably benign Het
Tctn3 A T 19: 40,607,267 L358H possibly damaging Het
Tk2 C T 8: 104,248,514 probably benign Het
Tm6sf2 C T 8: 70,077,914 R215C probably damaging Het
Tmbim6 T C 15: 99,406,674 I204T probably damaging Het
Tubgcp2 C A 7: 139,999,347 W675C probably damaging Het
Usp48 T A 4: 137,594,483 I62N probably damaging Het
Vmn2r74 T C 7: 85,952,283 T716A probably benign Het
Vps13b C A 15: 35,879,803 T3008K probably damaging Het
Wnk1 G A 6: 119,928,163 probably benign Het
Other mutations in Smad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Smad2 APN 18 76298495 missense possibly damaging 0.94
IGL00978:Smad2 APN 18 76299775 splice site probably benign
IGL01295:Smad2 APN 18 76302430 missense probably benign 0.05
IGL01887:Smad2 APN 18 76299894 missense probably damaging 1.00
IGL01960:Smad2 APN 18 76262484 intron probably benign
IGL02881:Smad2 APN 18 76299780 splice site probably null
IGL02977:Smad2 APN 18 76289164 missense possibly damaging 0.64
R0391:Smad2 UTSW 18 76289037 critical splice acceptor site probably null
R0523:Smad2 UTSW 18 76262552 missense probably benign
R0570:Smad2 UTSW 18 76289179 splice site probably benign
R0624:Smad2 UTSW 18 76299993 missense probably damaging 1.00
R1573:Smad2 UTSW 18 76262586 missense possibly damaging 0.89
R1953:Smad2 UTSW 18 76262705 missense possibly damaging 0.90
R2132:Smad2 UTSW 18 76288084 nonsense probably null
R2213:Smad2 UTSW 18 76304626 missense probably damaging 1.00
R3021:Smad2 UTSW 18 76262632 missense probably damaging 1.00
R3917:Smad2 UTSW 18 76287937 missense probably benign 0.42
R4503:Smad2 UTSW 18 76302592 missense probably benign 0.23
R5253:Smad2 UTSW 18 76288053 missense probably damaging 1.00
R5290:Smad2 UTSW 18 76262724 missense probably damaging 1.00
R5891:Smad2 UTSW 18 76299975 missense probably damaging 1.00
R6294:Smad2 UTSW 18 76289162 missense probably benign 0.31
R6879:Smad2 UTSW 18 76262654 missense possibly damaging 0.49
R7430:Smad2 UTSW 18 76288080 missense probably damaging 1.00
R7503:Smad2 UTSW 18 76286885 missense probably benign
R7757:Smad2 UTSW 18 76288013 missense probably benign 0.40
R8072:Smad2 UTSW 18 76286951 critical splice donor site probably null
Z1177:Smad2 UTSW 18 76288002 missense probably damaging 1.00
Z1177:Smad2 UTSW 18 76288003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCCAGAGCGTTGACAAAGA -3'
(R):5'- GCGAAAGGAAACTACTAGCCAGCAC -3'

Sequencing Primer
(F):5'- AGACAGCATCGTCATCAGTATAG -3'
(R):5'- TACTAGCCAGCACTTGTCAG -3'
Posted On2013-05-23