Incidental Mutation 'R4949:Clp1'
ID383648
Institutional Source Beutler Lab
Gene Symbol Clp1
Ensembl Gene ENSMUSG00000027079
Gene NameCLP1, cleavage and polyadenylation factor I subunit
Synonyms
MMRRC Submission 042546-MU
Accession Numbers

Genbank: NM_133840; MGI: 2138968

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location84722104-84727350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 84723742 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 361 (M361R)
Ref Sequence ENSEMBL: ENSMUSP00000129300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028475] [ENSMUST00000165219]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028475
AA Change: M361R

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000028475
Gene: ENSMUSG00000027079
AA Change: M361R

DomainStartEndE-ValueType
Pfam:CLP1_N 15 107 1.7e-36 PFAM
Pfam:CLP1_P 121 307 2e-79 PFAM
Pfam:Clp1 312 423 1.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138231
Predicted Effect possibly damaging
Transcript: ENSMUST00000165219
AA Change: M361R

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129300
Gene: ENSMUSG00000027079
AA Change: M361R

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:MobB 115 230 5.7e-24 PFAM
Pfam:Clp1 232 424 3e-62 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Clp1 family. The encoded protein is a multifunctional kinase which is a component of the tRNA splicing endonuclease complex and a component of the pre-mRNA cleavage complex II. This protein is implicated in tRNA, mRNA, and siRNA maturation. Mutations in this gene are associated with pontocerebellar hypoplasia type 10 (PCH10). Alternatively splice transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a kinase dead allele exhibit background sensitive lethality, motor neuron degeneration, defects in diaphragm innervation, progressive muscle weakness and impaired pre-tRNA processing. Mice homozygous for a globally targeted allele exhibit complete embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(6)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Clp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02725:Clp1 APN 2 84723864 missense probably benign 0.36
D4186:Clp1 UTSW 2 84725635 missense probably benign 0.00
R0540:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R0607:Clp1 UTSW 2 84725591 missense possibly damaging 0.69
R1954:Clp1 UTSW 2 84724051 missense probably damaging 1.00
R2908:Clp1 UTSW 2 84724144 missense possibly damaging 0.89
R4769:Clp1 UTSW 2 84725875 missense possibly damaging 0.53
R5568:Clp1 UTSW 2 84725978 nonsense probably null
R7191:Clp1 UTSW 2 84724146 nonsense probably null
Z1177:Clp1 UTSW 2 84725963 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACCGGATATCCATGATGAGAAG -3'
(R):5'- AACGTTCCAAGGACTTCCGG -3'

Sequencing Primer
(F):5'- GAAAGTTCTTAGGCAATGGGC -3'
(R):5'- CGGGAATGTAGAGATGAACGTATCC -3'
Posted On2016-04-27