Incidental Mutation 'R0333:Ppp2r5b'
ID38365
Institutional Source Beutler Lab
Gene Symbol Ppp2r5b
Ensembl Gene ENSMUSG00000024777
Gene Nameprotein phosphatase 2, regulatory subunit B', beta
SynonymsB'beta
MMRRC Submission 038542-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.587) question?
Stock #R0333 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location6227765-6235872 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 6229047 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025695] [ENSMUST00000025698] [ENSMUST00000025699] [ENSMUST00000113526] [ENSMUST00000113528]
Predicted Effect probably benign
Transcript: ENSMUST00000025695
SMART Domains Protein: ENSMUSP00000025695
Gene: ENSMUSG00000024777

DomainStartEndE-ValueType
low complexity region 6 25 N/A INTRINSIC
low complexity region 32 48 N/A INTRINSIC
Pfam:B56 62 467 5.2e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025698
SMART Domains Protein: ENSMUSP00000025698
Gene: ENSMUSG00000024784

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:DAN 17 126 5.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025699
SMART Domains Protein: ENSMUSP00000025699
Gene: ENSMUSG00000024786

DomainStartEndE-ValueType
Pfam:DUF4544 1 51 2.1e-36 PFAM
Pfam:DUF4544 49 110 2.1e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113526
SMART Domains Protein: ENSMUSP00000109154
Gene: ENSMUSG00000024784

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:DAN 16 123 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113528
SMART Domains Protein: ENSMUSP00000109156
Gene: ENSMUSG00000024786

DomainStartEndE-ValueType
Pfam:DUF4544 1 240 1.5e-131 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153155
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2A regulatory subunit B family. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes a beta isoform of the regulatory subunit B56 subfamily. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas1 T C 9: 106,241,281 N214S probably benign Het
Antxr1 A G 6: 87,188,838 probably benign Het
Atxn7l3 A T 11: 102,294,992 probably null Het
Cab39l A G 14: 59,499,611 E60G probably damaging Het
Cdc5l G T 17: 45,393,216 probably benign Het
Cux2 T C 5: 121,860,608 E1423G probably benign Het
Dbndd1 G T 8: 123,506,773 Q165K probably damaging Het
Drd1 C A 13: 54,054,063 C37F probably damaging Het
Elp3 G A 14: 65,590,593 P11L probably benign Het
F830045P16Rik A G 2: 129,472,857 Y167H probably damaging Het
Gimap3 G A 6: 48,765,730 Q89* probably null Het
Herc1 G A 9: 66,464,699 probably null Het
Hist3h2a C A 11: 58,954,859 S41* probably null Het
Ipo11 A G 13: 106,870,763 V603A probably benign Het
Kifap3 G A 1: 163,797,264 A130T probably damaging Het
Klhl23 A G 2: 69,833,897 Y530C probably damaging Het
Map4k1 C T 7: 28,999,761 probably benign Het
Mroh2b T A 15: 4,931,118 L778M probably damaging Het
Mtdh T C 15: 34,118,101 S344P possibly damaging Het
Ncoa3 T G 2: 166,054,291 N371K probably damaging Het
Ncor2 C A 5: 125,034,344 probably benign Het
Nrn1l A G 8: 105,894,420 E48G probably benign Het
Nudcd1 A G 15: 44,401,287 I271T probably benign Het
Olfr23 A T 11: 73,940,767 I174F possibly damaging Het
Olfr31 T C 14: 14,328,498 L129P probably damaging Het
Pard3b A G 1: 62,230,212 N653S probably benign Het
Park2 T C 17: 11,067,140 F6L probably damaging Het
Plekhg1 A C 10: 3,964,419 K1380N probably damaging Het
Ppara T A 15: 85,790,960 I210N probably damaging Het
Prr14l A G 5: 32,827,993 L1386P probably damaging Het
Ralgapa1 A G 12: 55,782,900 probably benign Het
Reln A T 5: 21,929,242 L2563I probably damaging Het
Rps7 A G 12: 28,631,201 probably benign Het
Rslcan18 T C 13: 67,098,622 K309E probably damaging Het
Sec14l5 C T 16: 5,167,066 T92M probably damaging Het
Slc22a8 G A 19: 8,608,150 probably benign Het
Smad2 G A 18: 76,262,621 A44T probably damaging Het
Smcr8 T C 11: 60,780,222 V732A possibly damaging Het
Spata2l A G 8: 123,233,632 F306S probably damaging Het
Stab2 T C 10: 86,841,627 D2552G probably benign Het
Tctn3 A T 19: 40,607,267 L358H possibly damaging Het
Tk2 C T 8: 104,248,514 probably benign Het
Tm6sf2 C T 8: 70,077,914 R215C probably damaging Het
Tmbim6 T C 15: 99,406,674 I204T probably damaging Het
Tubgcp2 C A 7: 139,999,347 W675C probably damaging Het
Usp48 T A 4: 137,594,483 I62N probably damaging Het
Vmn2r74 T C 7: 85,952,283 T716A probably benign Het
Vps13b C A 15: 35,879,803 T3008K probably damaging Het
Wnk1 G A 6: 119,928,163 probably benign Het
Other mutations in Ppp2r5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Ppp2r5b APN 19 6230968 missense probably damaging 1.00
IGL02714:Ppp2r5b APN 19 6234707 missense probably damaging 0.99
IGL02937:Ppp2r5b APN 19 6230986 missense probably damaging 1.00
PIT4696001:Ppp2r5b UTSW 19 6234683 missense probably benign 0.12
R0114:Ppp2r5b UTSW 19 6228431 missense probably benign
R0627:Ppp2r5b UTSW 19 6232634 unclassified probably benign
R1477:Ppp2r5b UTSW 19 6230227 missense probably benign 0.01
R1628:Ppp2r5b UTSW 19 6230905 critical splice donor site probably null
R4066:Ppp2r5b UTSW 19 6229330 missense probably damaging 1.00
R4834:Ppp2r5b UTSW 19 6230510 missense possibly damaging 0.81
R5854:Ppp2r5b UTSW 19 6230944 missense probably damaging 1.00
R5895:Ppp2r5b UTSW 19 6234734 missense probably damaging 1.00
R6102:Ppp2r5b UTSW 19 6234738 missense probably benign 0.00
R6285:Ppp2r5b UTSW 19 6230536 missense probably benign 0.08
R7087:Ppp2r5b UTSW 19 6232550 missense possibly damaging 0.46
R7391:Ppp2r5b UTSW 19 6228514 missense probably benign 0.00
R7576:Ppp2r5b UTSW 19 6228484 missense possibly damaging 0.76
R7799:Ppp2r5b UTSW 19 6232598 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CCTTCACTGTCACCCCACTGTAAAG -3'
(R):5'- TCATTGAGGACAACTGCCACACTG -3'

Sequencing Primer
(F):5'- CCCACTGTAAAGTGATTAGGACTC -3'
(R):5'- ATTTGGGACCCTCTACCAAGTG -3'
Posted On2013-05-23