Incidental Mutation 'R4949:Ttpal'
ID383650
Institutional Source Beutler Lab
Gene Symbol Ttpal
Ensembl Gene ENSMUSG00000017679
Gene Nametocopherol (alpha) transfer protein-like
Synonyms3110080A02Rik, 5830472M02Rik
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R4949 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location163602314-163619013 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 163613751 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 220 (R220Q)
Ref Sequence ENSEMBL: ENSMUSP00000128922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109405] [ENSMUST00000109408] [ENSMUST00000156839] [ENSMUST00000171696]
Predicted Effect silent
Transcript: ENSMUST00000109405
SMART Domains Protein: ENSMUSP00000105032
Gene: ENSMUSG00000017679

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
CRAL_TRIO_N 78 103 4.17e-8 SMART
Blast:SEC14 122 153 7e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000109408
AA Change: R220Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105035
Gene: ENSMUSG00000017679
AA Change: R220Q

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
CRAL_TRIO_N 78 103 4.17e-8 SMART
SEC14 122 280 1.57e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132904
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144729
Predicted Effect probably benign
Transcript: ENSMUST00000156839
SMART Domains Protein: ENSMUSP00000121527
Gene: ENSMUSG00000017679

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
CRAL_TRIO_N 78 103 4.17e-8 SMART
Pfam:CRAL_TRIO 124 196 5.8e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171696
AA Change: R220Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128922
Gene: ENSMUSG00000017679
AA Change: R220Q

DomainStartEndE-ValueType
low complexity region 22 30 N/A INTRINSIC
CRAL_TRIO_N 78 103 4.17e-8 SMART
SEC14 122 280 1.57e-30 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Sox18 G A 2: 181,671,224 Q100* probably null Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Ttpal
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Ttpal APN 2 163607320 missense probably damaging 1.00
IGL02081:Ttpal APN 2 163615388 missense probably benign 0.04
IGL02561:Ttpal APN 2 163607449 missense probably damaging 1.00
IGL02643:Ttpal APN 2 163607220 utr 5 prime probably benign
P0023:Ttpal UTSW 2 163611809 missense probably damaging 1.00
R1562:Ttpal UTSW 2 163615403 missense probably benign 0.00
R1670:Ttpal UTSW 2 163615366 missense possibly damaging 0.90
R2879:Ttpal UTSW 2 163615583 unclassified probably null
R4915:Ttpal UTSW 2 163607477 missense probably damaging 1.00
R7471:Ttpal UTSW 2 163607025 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCCCATGTTTGTTCACACTG -3'
(R):5'- AGAGAAAGGATGGCTGTTTCTC -3'

Sequencing Primer
(F):5'- TTCACACTGCGGTGGCTCTG -3'
(R):5'- GATGGCTGTTTCTCTGTACCATAAGC -3'
Posted On2016-04-27