Incidental Mutation 'R4949:Sox18'
ID383653
Institutional Source Beutler Lab
Gene Symbol Sox18
Ensembl Gene ENSMUSG00000046470
Gene NameSRY (sex determining region Y)-box 18
SynonymsSry-related HMG-box gene 18, Ragl
MMRRC Submission 042546-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4949 (G1)
Quality Score169
Status Not validated
Chromosome2
Chromosomal Location181669836-181671640 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 181671224 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 100 (Q100*)
Ref Sequence ENSEMBL: ENSMUSP00000062759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054491]
Predicted Effect probably null
Transcript: ENSMUST00000054491
AA Change: Q100*
SMART Domains Protein: ENSMUSP00000062759
Gene: ENSMUSG00000046470
AA Change: Q100*

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
HMG 78 148 4.08e-27 SMART
low complexity region 159 172 N/A INTRINSIC
Pfam:Sox_C_TAD 186 375 2.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. This protein plays a role in hair, blood vessel, and lymphatic vessel development. Mutations in this gene have been associated with recessive and dominant forms of hypotrichosis-lymphedema-telangiectasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for some mutant alleles show low prenatal viability and cardiovascular defects. Most mutants show darkened coats, reduced zigzag hairs and, depending on the allele, sparse abnormal hair and edema. Heterozygotes show similar or milder defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933425L06Rik T A 13: 105,109,706 S258R probably damaging Het
Acox3 T C 5: 35,612,106 V692A probably benign Het
Bcl2l13 G T 6: 120,887,230 G382W probably damaging Het
Cdhr5 T A 7: 141,272,644 N353I probably damaging Het
Chil4 A G 3: 106,206,092 S170P possibly damaging Het
Clp1 A C 2: 84,723,742 M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 K382R unknown Het
Dsg2 T A 18: 20,590,184 D422E probably damaging Het
Dync1h1 C A 12: 110,658,126 T3700N probably damaging Het
Gm14295 A C 2: 176,809,676 T320P probably damaging Het
Ido2 T G 8: 24,533,954 probably null Het
Ift140 T A 17: 25,094,665 S1357T probably benign Het
Insr T G 8: 3,185,059 E145A probably benign Het
Itpripl1 A G 2: 127,141,407 M265T probably benign Het
Kcnb1 G T 2: 167,105,601 N442K probably damaging Het
Kifc5b C A 17: 26,925,514 R536S probably damaging Het
Klf6 A T 13: 5,864,948 S129C probably benign Het
Lpin2 C G 17: 71,231,339 P327A probably damaging Het
Lsm1 T C 8: 25,802,037 V114A probably benign Het
Map7d1 C T 4: 126,235,053 W218* probably null Het
N4bp2 T A 5: 65,821,799 probably null Het
Rheb A T 5: 24,803,731 I163K possibly damaging Het
Rph3a T C 5: 120,963,834 D113G probably damaging Het
Scn8a A G 15: 101,029,782 N1381D probably damaging Het
Sdsl T A 5: 120,459,805 N208Y possibly damaging Het
Serpinb9e A G 13: 33,251,608 N8S possibly damaging Het
Taar8b C T 10: 24,091,927 C123Y probably damaging Het
Tas2r124 A G 6: 132,754,895 I56V possibly damaging Het
Tes C A 6: 17,100,360 H331N probably benign Het
Tmbim1 T G 1: 74,295,365 D12A probably damaging Het
Tmprss4 T C 9: 45,175,543 I307V possibly damaging Het
Ttll1 A T 15: 83,502,173 M77K probably null Het
Ttpal G A 2: 163,613,751 R220Q probably damaging Het
Vmn1r230 T A 17: 20,847,363 H271Q probably benign Het
Vmn2r32 A G 7: 7,464,084 I815T probably benign Het
Other mutations in Sox18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Sox18 APN 2 181670420 missense probably benign
IGL01691:Sox18 APN 2 181671350 missense possibly damaging 0.85
nandou UTSW 2 181670895 missense probably damaging 1.00
R4473:Sox18 UTSW 2 181670876 missense probably damaging 0.97
R4476:Sox18 UTSW 2 181670876 missense probably damaging 0.97
R4710:Sox18 UTSW 2 181670895 missense probably damaging 1.00
R5249:Sox18 UTSW 2 181671178 splice site probably null
R7056:Sox18 UTSW 2 181671487 missense probably damaging 0.99
R7083:Sox18 UTSW 2 181670372 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- AAGGGAGCCTGTTAGTGGAC -3'
(R):5'- CCAGCTGGAATGCAGAGATC -3'

Sequencing Primer
(F):5'- GACTAGCCAAACCGTCGTG -3'
(R):5'- AATGCAGAGATCGCCGC -3'
Posted On2016-04-27