Incidental Mutation 'R4949:Sox18'
ID 383653
Institutional Source Beutler Lab
Gene Symbol Sox18
Ensembl Gene ENSMUSG00000046470
Gene Name SRY (sex determining region Y)-box 18
Synonyms Sry-related HMG-box gene 18, Ragl
MMRRC Submission 042546-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4949 (G1)
Quality Score 169
Status Not validated
Chromosome 2
Chromosomal Location 181311630-181313433 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 181313017 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 100 (Q100*)
Ref Sequence ENSEMBL: ENSMUSP00000062759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054491]
AlphaFold P43680
Predicted Effect probably null
Transcript: ENSMUST00000054491
AA Change: Q100*
SMART Domains Protein: ENSMUSP00000062759
Gene: ENSMUSG00000046470
AA Change: Q100*

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
low complexity region 41 61 N/A INTRINSIC
HMG 78 148 4.08e-27 SMART
low complexity region 159 172 N/A INTRINSIC
Pfam:Sox_C_TAD 186 375 2.2e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. This protein plays a role in hair, blood vessel, and lymphatic vessel development. Mutations in this gene have been associated with recessive and dominant forms of hypotrichosis-lymphedema-telangiectasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for some mutant alleles show low prenatal viability and cardiovascular defects. Most mutants show darkened coats, reduced zigzag hairs and, depending on the allele, sparse abnormal hair and edema. Heterozygotes show similar or milder defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,769,450 (GRCm39) V692A probably benign Het
Bcl2l13 G T 6: 120,864,191 (GRCm39) G382W probably damaging Het
Cdhr5 T A 7: 140,852,557 (GRCm39) N353I probably damaging Het
Chil4 A G 3: 106,113,408 (GRCm39) S170P possibly damaging Het
Clp1 A C 2: 84,554,086 (GRCm39) M361R possibly damaging Het
Cylc2 A G 4: 51,229,804 (GRCm39) K382R unknown Het
Dsg2 T A 18: 20,723,241 (GRCm39) D422E probably damaging Het
Dync1h1 C A 12: 110,624,560 (GRCm39) T3700N probably damaging Het
Gm14295 A C 2: 176,501,469 (GRCm39) T320P probably damaging Het
Ido2 T G 8: 25,023,970 (GRCm39) probably null Het
Ift140 T A 17: 25,313,639 (GRCm39) S1357T probably benign Het
Insr T G 8: 3,235,059 (GRCm39) E145A probably benign Het
Itpripl1 A G 2: 126,983,327 (GRCm39) M265T probably benign Het
Kcnb1 G T 2: 166,947,521 (GRCm39) N442K probably damaging Het
Kifc5b C A 17: 27,144,488 (GRCm39) R536S probably damaging Het
Klf6 A T 13: 5,914,947 (GRCm39) S129C probably benign Het
Lpin2 C G 17: 71,538,334 (GRCm39) P327A probably damaging Het
Lsm1 T C 8: 26,292,065 (GRCm39) V114A probably benign Het
Map7d1 C T 4: 126,128,846 (GRCm39) W218* probably null Het
N4bp2 T A 5: 65,979,142 (GRCm39) probably null Het
Nt5el T A 13: 105,246,214 (GRCm39) S258R probably damaging Het
Rheb A T 5: 25,008,729 (GRCm39) I163K possibly damaging Het
Rph3a T C 5: 121,101,897 (GRCm39) D113G probably damaging Het
Scn8a A G 15: 100,927,663 (GRCm39) N1381D probably damaging Het
Sdsl T A 5: 120,597,870 (GRCm39) N208Y possibly damaging Het
Serpinb9e A G 13: 33,435,591 (GRCm39) N8S possibly damaging Het
Taar8b C T 10: 23,967,825 (GRCm39) C123Y probably damaging Het
Tas2r124 A G 6: 132,731,858 (GRCm39) I56V possibly damaging Het
Tes C A 6: 17,100,359 (GRCm39) H331N probably benign Het
Tmbim1 T G 1: 74,334,524 (GRCm39) D12A probably damaging Het
Tmprss4 T C 9: 45,086,841 (GRCm39) I307V possibly damaging Het
Ttll1 A T 15: 83,386,374 (GRCm39) M77K probably null Het
Ttpal G A 2: 163,455,671 (GRCm39) R220Q probably damaging Het
Vmn1r230 T A 17: 21,067,625 (GRCm39) H271Q probably benign Het
Vmn2r32 A G 7: 7,467,083 (GRCm39) I815T probably benign Het
Other mutations in Sox18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Sox18 APN 2 181,312,213 (GRCm39) missense probably benign
IGL01691:Sox18 APN 2 181,313,143 (GRCm39) missense possibly damaging 0.85
nandou UTSW 2 181,312,688 (GRCm39) missense probably damaging 1.00
R4473:Sox18 UTSW 2 181,312,669 (GRCm39) missense probably damaging 0.97
R4476:Sox18 UTSW 2 181,312,669 (GRCm39) missense probably damaging 0.97
R4710:Sox18 UTSW 2 181,312,688 (GRCm39) missense probably damaging 1.00
R5249:Sox18 UTSW 2 181,312,971 (GRCm39) splice site probably null
R7056:Sox18 UTSW 2 181,313,280 (GRCm39) missense probably damaging 0.99
R7083:Sox18 UTSW 2 181,312,165 (GRCm39) missense possibly damaging 0.88
R8109:Sox18 UTSW 2 181,313,293 (GRCm39) missense possibly damaging 0.68
R8284:Sox18 UTSW 2 181,312,751 (GRCm39) missense probably damaging 1.00
R9341:Sox18 UTSW 2 181,312,231 (GRCm39) missense probably damaging 0.99
R9343:Sox18 UTSW 2 181,312,231 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGGAGCCTGTTAGTGGAC -3'
(R):5'- CCAGCTGGAATGCAGAGATC -3'

Sequencing Primer
(F):5'- GACTAGCCAAACCGTCGTG -3'
(R):5'- AATGCAGAGATCGCCGC -3'
Posted On 2016-04-27